More Fields
Strain Species Genotype
PS9052 C. elegans flp-22(sy1608) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of flp-22. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTTTGTGTTGTTTTGATGGTATCATTGGTGTCGG right flanking sequence: CTCAGGTCTTCGATTTGGATGGACAACAGTTGGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGTATCATTGGTGTCGGCTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9058 C. elegans shl-1(sy1614) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of shl-1. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTTCGAGACAGCCCATGCCACAGGCCCCAGTTGCAA right flanking sequence: TACAGgttaggtttggtgggaataattttctaaat inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAGGCCCCAGTTGCAATAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9191 C. elegans kvs-4(sy1622) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kvs-4. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gttcctaacatgattgttgaaaataattttccagAA right flanking sequence: GCACGGAGGAGGAGCGACGCACAGTGCAGACAGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCGCTCCTCCTCCGTGCTTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9192 C. elegans mgl-1(sy1623) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of mgl-1. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTGCACTTATTCTTGATTCATGCTCAAATCCAGCA right flanking sequence: TATGCGCTAAACCAGAGTTTAGATTTTGTGAGAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTCTGGTTTAGCGCATATGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9195 C. elegans col-46(sy1626) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-46. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTCGTTTATTGTTTCTGTAGGACCCCTTGCCTCAA right flanking sequence: TACTTCGACCGGCTATTCAGAATACTGTCAACGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATAGCCGGTCGAAGTATTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9197 C. elegans col-40(sy1628) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-40. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: aactattttcagGTCGAATTCTGCAAGCACCGAAC right flanking sequence: TGACGGACTCTGGGATGAGTTCCACAGAgtaagta inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTGCAAGCACCGAACTGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9199 C. elegans col-54(sy1630) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-54. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTCTTCTTGTTGCTGGATCATTATTCTTTGAAGC right flanking sequence: TCAAGGATTTTTAGAGACTTCACTTGATGAAATTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCATTATTCTTTGAAGCTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9201 C. elegans col-133(sy1632) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-133. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGCAAGCACTCTGCTCGTGACATTTTCGCCGAGG right flanking sequence: TAAACCACATCCGTTCTTCACCAAAGAACGCTTCTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGAACGGATGTGGTTTACCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9355 C. elegans col-102(sy1735) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-102. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATGAGGTCTCTCAAGATCTTACACAATTCCGTGG right flanking sequence: ATACTATGATGATGCGTGGAGAACCATGATGGTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGCATCATCATAGTATCCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9359 C. elegans col-114(sy1739) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-114. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTCAAGCAGCTCATTAATACTGAAGTTGTCTCTT right flanking sequence: AGgtaagattaatgaaccatgtgaataatatg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACTGAAGTTGTCTCTTGTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9361 C. elegans oac-19(sy1741) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-19. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTCTTGCTATAATTGCAGTTCTAGGCTTCCACTT right flanking sequence: CTACCCTGACACCTTCCCAAATGGATATCTTGGAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAAGGTGTCAGGGTAGAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9362 C. elegans oac-45(sy1742) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-45. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTCTTGGATTTCATTTCTACCCTAATCAGTTTCCC right flanking sequence: AATGGGTACCTTGGAGTTGATCAgtaaggtttttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACCCTAATCAGTTTCCCAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9363 C. elegans col-116(sy1743) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-116. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTAATTTCCGCAGTTTCAATATTTGGTGCCCTAT right flanking sequence: GTGTGGCAGCTTCAATTTTAGTTGGTATTAACGAA inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATATTTGGTGCCCTATGTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9364 C. elegans col-109(sy1744) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-109. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatcaccttttcccccattcgttttttccagTC right flanking sequence: GACCGCCAGAGATATCATGTCTGAAATCAGTCACAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATATCTCTGGCGGTCGAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9366 C. elegans srx-12(sy1746) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-12. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCATTGCAAATTTTGGGGTTCTATTTGTATTCTGC right flanking sequence: ACATGGGTCACGCCGACCACTATTATgtaggtttttg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTATTTGTATTCTGCACA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9374 C. elegans sra-14(sy1748) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of sra-14. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCAATCGGGTGTTTTGTTGGAGTTGCCTACT right flanking sequence: GTATAAGGTTTATGCGGAAACACCCGATTTTCAGCG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCGCATAAACCTTATACAGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9376 C. elegans srg-48(sy1750) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srg-48. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTCTCCAGAACTATTCAATTTCTTCATGTTTTGCG right flanking sequence: GGCTGGCATTTCTTCATCTTCAGTCATGTAGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTTCATGTTTTGCGGGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9378 C. elegans srv-28(sy1752) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srv-28. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTATACTATGGAATGTCGATTTTAAGTCTTCCCTTATA right flanking sequence: CTTTGGTGTTCTCATTTGTTTGTTGAGATTGAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTAAGTCTTCCCTTATACTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9380 C. elegans kcnl-2(sy1754) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. left flanking sequence: GTGATGTAAACGAAATTCCAAAAACGAATGGAGG right flanking sequence: AGGACATCCAATTGTTAGAAGAAAAAGTGGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCAAAAACGAATGGAGGTCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9381 C. elegans kcnl-2(sy1755) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. left flanking sequence: GAATGGAGCAATTGGAGATGATTCAACAGTTCCAT right flanking sequence: TGATGGACGAAAAAGATGATAACAGgttagttattc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATTCAACAGTTCCATTGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9419 C. elegans col-131(sy1765) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-131. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTTTCGGTGCTGGTATTTGTCCTTCAGACCAAGA right flanking sequence: ATGATTTGGACCAAGTTTGGGCCGAGTTTGATCAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTTGGTCCAAATCATTCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9421 C. elegans col-158(sy1767) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-158. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GACCGCCGGGGCTTTGTGCCTCTCCTCGGCCACTC right flanking sequence: TCATCCTCTCGCTTTATGCAATTTTCTCAATTTATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATAAAGCGAGAGGATGAGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9458 C. elegans srv-8(sy1771) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srv-8. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTTTATTTTGTAGAAATACAAATTTTATTCACT right flanking sequence: TCGAGGAATTCTACTTTCAAAGgtcagagaagata inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACAAATTTTATTCACTTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9460 C. elegans col-2(sy1773) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGTTGTCGCCGTTGTCTCTGTTTTCATCACATTGC right flanking sequence: CAATGGTTTATAACTATGTTAATAATGTGAAGAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTTTCATCACATTGCCAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9464 C. elegans srg-6(sy1777) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srg-6. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ATTTCAAAAATGATTTACGTGATACAAGTGAAACA right flanking sequence: TCGAGGTGATTATCATGAACAGAGGCGGTTTTGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGATACAAGTGAAACATCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9466 C. elegans fbxa-199(sy1779) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of fbxa-199. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCGTTTACTATTTTAACTGTTGGCCTGGCAACTTC right flanking sequence: GGACGGCGTGTTTTCAACGCTGTACTTGTTTTACG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTGGCCTGGCAACTTCGGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9467 C. elegans col-37(sy1780) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-37. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATCCATGTGATGACCGATATTAGCAACTTCCAAG right flanking sequence: ATGAGGTTATCTCCGATTTAAGCAATTTCAAGCAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTAGCAACTTCCAAGATG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9469 C. elegans col-43(sy1782) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-43. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTATGCTGCCGTCTCATTCTCAATTGTGGCCGTTC right flanking sequence: TTTCGGTGGTGCTCACACTACCAATGGTCTACAAT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTCAATTGTGGCCGTTCTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9485 C. elegans col-36(sy1783) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-36. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTTGCGGTTGCTGTCTCAACTGCAGCCGTCATT right flanking sequence: TCAAGgtaattaaaaacttcactcttcagattatc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAACTGCAGCCGTCATTTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9487 C. elegans srd-32(sy1785) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srd-32. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACCATATACTGTATTCTTGGCGAACACCTCTA right flanking sequence: TAACGCAGCTAGGGTATTGCATATGTTTCCTCTTAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATACCCTAGCTGCGTTATAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9491 C. elegans col-45(sy1789) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-45. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGGCCGGGACGAGGAGCTCGTGGCCCGAACCAAGC right flanking sequence: GAGCGGTTAAAGGCACATGGCTCTTCGGACAGTAT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGTGGCCCGAACCAAGCGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9494 C. elegans col-73(sy1792) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-73. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GACCAGATGCTCCAAATGAGCACGTTCAACCAACT right flanking sequence: CCAGCCGATTTCTGCTTCGAGTGCCCACCAGGACC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGCAGAAATCGGCTGGAGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9496 C. elegans him-5(e1490) V; seb-3(sy1794) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of seb-3 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATTGAAAAAACTGGAAAACAGTTCGTATAATCCG right flanking sequence: GGgtgggtcaagttccagtgttcagtttttttaaag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAGTTCGTATAATCCGGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9498 C. elegans ufd-3(sy1796) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ufd-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. Left flanking sequence: CTCATCATTCACTGAATTCGTATTTCTGTGATCGTGA. Right flanking sequence: ACGTGGTCAGGAACTTGTCGGAAGATTAATTGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTTCTGTGATCGTGAACG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9500 C. elegans ufd-3(sy1798) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ufd-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. Left flanking sequence: CAATTTCCCATGTTATTGAAGCCCACAAATCCGACA. Right flanking sequence: CAAAGGCTTTGGCAGTTACTCAAGGCGGATGCTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCCCACAAATCCGACACAA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9502 C. elegans srsx-40(sy1800) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srsx-40. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTATTTTGACAATCGACAGAATAATTGCCACGT right flanking sequence: GTACACCTATTCAATACAAGAATTTGAAACATTGTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTATTGAATAGGTGTACACG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9504 C. elegans him-5(e1490) V; str-74(sy1802) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of str-74 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGGAATATTGTTTTCGGGAATAGAAATCCTTGC right flanking sequence: CAGACCATTCGCTCATAATTATAACAACAGTTTGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATGAGCGAATGGTCTGGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9506 C. elegans col-84(sy1804) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-84. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatttttaaagcgaatttttctagCAAGAAACCGACG right flanking sequence: CAATGTGGAAGGATTTGGTTCAAATTGGCACCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAAATCCTTCCACATTGCGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9508 C. elegans kvs-2(sy1806) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kvs-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAATTGGTGAATCAAGGAGCACGACGATCACACATGA right flanking sequence: TTCCGgtttgattttcattgaattcgtgggaac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGACGATCACACATGATTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9520 C. elegans nlp-21(sy1807) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaaattgatactatgaaacattatatttccagCG right flanking sequence: CTTGTCATGGTGCTCAACGCCCAATACACTTCCG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGAGCACCATGACAAGCGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9527 C. elegans tns-1(sy1813) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of tns-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTCTCTAGAGTTATACAAAGACAAATTAGTGGTGC. Right flanking sequence: AGGAGGTGGAATTCTAAAGAAGAGTAATGGAAAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGACAAATTAGTGGTGCAGG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9529 C. elegans him-5(e1490) V; nlp-49(sy1815) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-49 into parental strain CB4088. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTGCTTTTGGCTGTTTTCTGCATTGCTGCCTAT. Right flanking sequence: CCTGGGCTGATGGGgtatgttccaatattgaacc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTGCATTGCTGCCTATGCCT Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9589 C. elegans fkh-2(sy1839) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of fkh-2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCCATCAAAGACAGTCCAGAAAAACGTCTCACATT. Right flanking sequence: GGCTGGAATTTACGAATACATCGTCACCAATTACC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GAAAAACGTCTCACATTGGC Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9594 C. elegans nlp-8(sy1844) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gttttcagTGCCTTCTTATCGGCTTTACTGCCGCCT. Right flanking sequence: ACCCCTACCTGATCTTTCCTGCTTCACCGTCCTCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAGATCAGGTAGGGGTAGG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9705 C. elegans asp-12(sy1899) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of asp-12. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAATCGCCAAAGATGCAAATGATGAGGCGAGGAGA. Right flanking sequence: ATGGGGAGCATACGTTCAACACAAGGCTGCCCTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGATGAGGCGAGGAGAATG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9707 C. elegans haf-6(sy1901) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of haf-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 2nd exon of the gene. Left flanking sequence: catatattttcccgttttttgcagCTTTTCCAGCT. Right flanking sequence: ATCCATGGCTTCACAAACCGATTTCAAGGACAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTGTGAAGCCATGGATAGC Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9711 C. elegans col-110(sy1737) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-110. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGGTTTTGACGGTTGGAGCAATGGTAACCCTTCC right flanking sequence: ACTAGCCTATCATTATGTTAATCAGTTGAGAAATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATAATGATAGGCTAGTGGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9712 C. elegans ins-32(sy1905) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ins-32 Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctttgtctgaaaATGACCTCGATTCTGTTGATCCTTC. Right flanking sequence: TATTGGTTATCACCGTCACCGGGATGTTCCAGGAG Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GATTCTGTTGATCCTTCTAT Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9714 C. elegans haf-6(sy1907) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of haf-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. Left flanking sequence: ctctgcactggattcccattcggagcacATGGTAC. Right flanking sequence: AAGAGGCGTTGAATAATGTGATGAAGGGCCGAACTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCGGAGCACATGGTACAAG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9716 C. elegans tat-3(sy1914) III. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of tat-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGTGGCAGAATCCTAAAAACGCATCCAGTAACA. Right flanking sequence: CGATGGCTGTTCCCAACTCAACCCATGCTTCCAC Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACGCATCCAGTAACACGA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.