More Fields
Strain Species Genotype
PD5994 C. elegans rps-23(cc5994)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by myo-2p::Venus-marked inversion. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus rps-23(cc5994) homozygotes (L1 arrest). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc5994 is an engineered mutation creating an early stop (A67*). Presumptive rps-23 null. Heterozygous rps-23(cc5994)/tmC5 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
PD5998 C. elegans rpl-5(cc5998)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::GFP-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP rpl-5(cc5998) homozygotes. Pick wild-type GFP+ to maintain. cc5998 is an engineered mutation creating an early stop (A166*). Presumptive rpl-5 null. Heterozygous rpl-5(cc5998)/mIn1 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
PHX1551 C. elegans ceh-51(syb1551[ceh-51::GFP]) V. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-51 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1587 C. elegans tab-1(syb1587[tab-1::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous tab-1 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1592 C. elegans ceh-5(syb1592[ceh-5::GFP]) I. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-5 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1610 C. elegans ceh-92(syb1610[ceh-92::GFP]) III. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-92 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1656 C. elegans ceh-8(syb1656[ceh-8::GFP]) I. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-8 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1658 C. elegans unc-4(syb1658[unc-4::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous unc-4 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1679 C. elegans ttx-1(syb1679[ttx-1::GFP]) V. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ttx-1 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1849 C. elegans ceh-23(syb1849[ceh-23::GFP)] III. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-23 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1884 C. elegans ceh-75(syb1884[ceh-75::GFP]) V. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-75 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX1955 C. elegans ceh-87(syb1995[ceh-87::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-87 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX2015 C. elegans ceh-58(syb2015[ceh-58::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-58 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX2517 C. elegans ceh-86(syb2517[ceh-86::GFP::FLAG]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-86 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PS10001 C. elegans F49B2.6(sy2028) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F49B2.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagCGATCTGGACGCCCAGCAACCCCTACCGCCA. Right flanking sequence: CACCTCATCCCACCGTCGAACCCGTGTATGTGTCG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACGGTGGGATGAGGTGTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10012 C. elegans F31E8.4(sy2030) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F31E8.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATTCTCTTCAGCTGGTGGAAAACTGGATCTCT. Right flanking sequence: GTCTGgtaagtctatatacttcggacacattcaaatttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGGAAAACTGGATCTCTGTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10014 C. elegans F54G2.1(sy2032) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F54G2.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cctgccaaaccgatgttttattgcagAGTCCAAGC. Right flanking sequence: GTCAGATGGGAACTTTTTCGAAAAAGTAACTGCTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAAGTTCCCATCTGACGCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10016 C. elegans F53A10.2(sy2034) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F53A10.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gatcATGTTCCACGTGTCAACAATGCTACCGTATAC. Right flanking sequence: TATTGGAGACGCCCAGCAGCTTCAAAGAAAACGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAATGCTACCGTATACTAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10018 C. elegans F36G3.3(sy2036) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F36G3.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGGATTACGCACCCACACAGCCCGTGTACCATCC. Right flanking sequence: AAGCAGTCATGTAACAGCTCCACCGTACCATTACC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTGTTACATGACTGCTTGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10020 C. elegans F53H1.3(sy2038) IV. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F53H1.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGCCGGATATTGAGCCATGGGACCGGTTTCGC. Right flanking sequence: GACTGGCTTCACTGCATTTGTGTGGTCACGTTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATGGGACCGGTTTCGCGAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10022 C. elegans F56F10.1(sy2040) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F56F10.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cttttttgaattctagTCACCATTTGGACCGGTT. Right flanking sequence: AACAGCGTCTGATGGGGCAAGCATTCAAGAGACTTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCCCATCAGACGCTGTTAAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10060 C. elegans F58G6.3(sy2042) IV. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F58G6.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATAATTCAATGGATATGGACATGAATCAAGGACCTTTC. Right flanking sequence: ATGTGGATGTGGTTTCATACAAAACCACAAGAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAAACCACATCCACATGAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10062 C. elegans M03C11.1(sy2044) III. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of M03C11.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCTTCAGCATTTTTCAGTCATACGGAGCATT. Right flanking sequence: GGGCGGGGAGCTTTTGGAAAAgttagttggttttttttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGTCATACGGAGCATTGGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10064 C. elegans R12C12.5(sy2046) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R12C12.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAGGAGAAGATCAAGGAAAAAAGCCGTAAGA. Right flanking sequence: GGAAGGCTCCAACTGCAGATGAAGCAATTGGAAATTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAAAAAAGCCGTAAGAGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10066 C. elegans F59C12.3(sy2048) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F59C12.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAGCGACGAGTGCATGCAGTGCCACCGACACCCATGT. Right flanking sequence: ATCAGGGAGAGACGAACATTTTAGACTCACTTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCCACCGACACCCATGTATC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10068 C. elegans R08E3.3(sy2050) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R08E3.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGCTTTCATCAGAGACGCTTGCCGACATCTT. Right flanking sequence: GAGTGgtatgttttttgtctgaaatctaattttattc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGCTTGCCGACATCTTGAG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10155 C. elegans T05C3.6(sy2066) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCATTCAATAGTTGCTATTGTGGCAGTGATTATAA. Right flanking sequence: CAACGGCAATATGGCTCACGgttagtttaaatatc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTGGCAGTGATTATAACAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10157 C. elegans R12C12.6(sy2068) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R12C12.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGATGCATTTCTTGCAAATTGCGACTGCCGTTA. Right flanking sequence: TGAGTCACGAAACACTGTGCTCTTAAAAGTAGTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGTGTTTCGTGACTCATAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10158 C. elegans T05E12.3(sy2069) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05E12.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATATTTTTAATATTTTTTATTTTTCGACTCCAGGC. Right flanking sequence: GCAAGgtaagtaagaattattgttttttatttatt. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTCTTACTTACCTTGCGCC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10160 C. elegans T05E7.3(sy2072) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05E7.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAAAGAAGCAGAGATAATTAATGGTGAAACCAGAA. Right flanking sequence: TGGATGTGAACAGAACATCCGAACTCGAGgtttta. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTCTGTTCACATCCATTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10162 C. elegans nlp-50(sy2074) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-50. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gcagtttcacacaaaccATGCGCTTCTCCGTCT. Right flanking sequence: TTGTTGCTCTATTTGCTCTTCTTGCTGTCTCTTATG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCAAATAGAGCAACAAAGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10163 C. elegans T08G3.13(sy2075) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T08G3.13. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctattttgattgaattATGTCTGTTATCGAGTTATGTGT. Right flanking sequence: CGGAGGACAGAAGTTCACAACGACGAAAACTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATCGAGTTATGTGTCGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10165 C. elegans nlp-51(sy2053) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtttttcttcagtttcaaatcaaaATGCGATTCCTCA. Right flanking sequence: TCTTGGCTCTCCTCGTGCTCTTCGCCATCACCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAAAATGCGATTCCTCATCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS10170 C. elegans gldi-2(sy2058) II. Show Description
T13C2.6. Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of gldi-2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTGATTTCAATGGCCACCATTTCGGTGGGCCTCCA. Right flanking sequence: ACCGATGGGAGCACCTACAAGAAgtatgttttc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAGGTGCTCCCATCGGTTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS7731 C. elegans K03E5.2(sy1082) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGG Reference: Wang H, et al. G3 (Bethesda).
PS7734 C. elegans T05C3.2(sy1080) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAA Right flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7778 C. elegans clik-1(sy1084) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
PS7783 C. elegans K03E5.2(sy1086) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaaattttcagAAGCTGGCCTCAAAATTGCCGCCG Right flanking sequence: TCTCGAGGTGCCAAGCAATGAACAATTGGAGAGGAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTGCTTGGCACCTCGACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7833 C. elegans Y106G6H.8(sy1076) I. Show Description
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of Y106G6H.8 Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTAATCTCCCCACCAAGTGTCGATATGTCTCCAATT; right flanking sequence: ATTCGTCTGGCTGGCCTCTCGGGAGCTGTTGCCATTTC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
PS7837 C. elegans aex-2(sy1078) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of aex-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGAAACGGCTTTTATGGATTACTGCAGCGACATG Right flanking sequence: GGGAGGACTTTATGCAATGAACATCGCACTTGTCA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTACTGCAGCGACATGGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7858 C. elegans C01B10.10(sy1114) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: catcatcagAATATGGACCCGCGTGTATGTCCAATT Right flanking sequence: CAACATGGACCCAGAGCCCTCAAAAATGGGTCGATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCTGGGTCCATGTTGAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7909 C. elegans C56G2.15(sy1120) III. Show Description
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C56G2.15. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCGTGAGCATTCACAGAAAAAATCATGCCGTCA; right flanking sequence: GTCCCCTCCAATGTCGTTTTTGTTGCTCAATAAGG; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
PS7911 C. elegans C53C9.2(sy1122)/tmC30[ubc-17(tmIs1243)] X. Show Description
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C53C9.2. lethal strain balanced with tmC30[ubc-17(tmIs1243)] X (from parental strain FX30236; dominant red pharynx and recessive Lon Mec); this strain segregates wild type, long animals, and L1 arrested homozygotes. Pick wild-type animals to maintain the heterozygotes. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCTGTCGGTATGCCACGTTGGAATATCACCAAGG; right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
PS7922 C. elegans C01B10.4(sy1131) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATACACACTTCATTTGGTCATTTGGAAGGTGCAGA Right flanking sequence: GATAGGAGATTATCATTTGTTCAAAAAAATTCCATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CATTTGGAAGGTGCAGAGAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7951 C. elegans adm-4(sy1161) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of adm-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTGTTGATGACACGTTACATCTAGAGCCATCT Right flanking sequence: TACCCGCATCAACTTTCTGATGATCTTGGGCCTGTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GAAAGTTGATGCGGGTAAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7953 C. elegans C23H4.2(sy1163) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C23H4.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtaattgaaacgaagaccatgccatgcagttccagAG Right flanking sequence: TGTTCCGTTTGCAAAGCCACCAATTGGAAATTTGC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTTTGCAAACGGAACACTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7960 C. elegans C04G6.4(sy1165) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C04G6.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGAAGCCACTTTCTTTCGAAATGCCAAAACCGCCA Right flanking sequence: GTTCTCCAGCCAAATATTGCCTCACTTCTACAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATATTTGGCTGGAGAACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7962 C. elegans ttc-36(sy1167) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ttc-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGCTCAGTTTGCAGCTCGAGAGAGAAGGTGTCG Right flanking sequence: cCGTTGGCAGAAGGTGTACGGTTGGATGAAGCTATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAGAGAGAAGGTGTCGCGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8008 C. elegans ZC376.2(sy1170) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZC376.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCCTGGGACGGAGTTTTGGAGGCGAAGGAGTATA Right flanking sequence: AAGCGGCTTGTATGAGTGATCAGAAgtaagagata inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGGCGAAGGAGTATAAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8010 C. elegans cpn-4(sy1172) I. Show Description
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of cpn-4 (F49D11.8). Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGCAAGCAAGTTCAATGATGTTGAAGCTGGATACT; right flanking sequence: TGTTGGAATGGATTCGGgtaagatttgggtagatt; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).