More Fields
Strain Species Genotype
ONA20 C.elegans yokSi3 II; spe-41(sy693) unc-119(ed3) III. Show Description
yokSi3 [spe-11p::trp-3A::TagRFP-T::tbb-2 3'UTR + Cbr-unc-119(+)] II. Reference: Takayama J & Onami S. Cell Rep. 2016 Apr 19;15(3):625-637.
OU247 C. elegans zyIs1. Show Description
zyIs1 [lin-11::RFP + rol-6(su1006)]. Roller. Reference: Sanchez-Alvarez L, et al. PLoS Genet. 2011 Sep;7(9):e1002257.
PS5552 C. elegans unc-119(ed4) III; syEx974. Show Description
syEx974 [POPFOP + unc-119(+)]. Pick non-Unc and RFP+. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS6187 C. elegans pha-1(e2123) unc-119(ed4) III; syEx1155. Show Description
syEx1155 [myo-3p::tomm-20::mRFP::3xMyc + Cbr-unc-119(+)]. Maintain at 15C. Pick non-Unc to maintain array.
PS6192 C. elegans syIs243. Show Description
syIs243 [myo-3p::TOM20::mRFP + unc-119(+) + pBS Sk+]. Integrated from PS6053. Strain has been outcrossed, but not known if unc-119 mutation is still present in the background.
PS6843 C. elegans syIs300 V. Show Description
syIs300 [15xUAS::?pes-10::GFP::unc-54 3'UTR + ttx-3p::RFP + pBlueScript].  GFP cGAL effector.  Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6844 C. elegans syIs301 V. Show Description
syIs301 [myo-2p:NLS::GAL4SC::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].  myo-2 cGAL driver for pharyngeal muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6872 C. elegans syIs302 III. Show Description
syIs302 [15xUAS::?pes-10::GFP::unc-54 3'UTR + ttx-3p::RFP + pBlueScript].  GFP cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6961 C. elegans syIs334 X. Show Description
syIs334 [rab-3p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP +  pBlueScript].  rab-3 cGAL driver for the whole nervous system.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6963 C. elegans syIs336 X. Show Description
syIs336 [rab-3p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP +  pBlueScript].  rab-3 cGAL driver for the whole nervous system.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6974 C. elegans syIs337 III. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + pBluescript].  GFP cGAL effector.  Weak background fluorescence in some head neurons and the head mesodermal cell.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7044 C. elegans syIs341 IV. Show Description
syIs341 [15xUAS::?pes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  channelrhodopsin cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7045 C. elegans syIs342 II. Show Description
syIs342 [15xUAS::?pes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  channelrhodopsin cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7149 C. elegans syIs390 X. Show Description
syIs390 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)].  GFP cGAL effector.  Weak background fluorescence in some head neurons and the head mesodermal cell.  [NOTE: (03/18/2020) a user has reported syIs390 does not map to LG X] Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7154 C. elegans syIs391 IV. Show Description
syIs391 [myo-2p::NLS::GAL4SK::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].  myo-2 cGAL driver for pharyngeal muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7160 C. elegans syIs393 IV. Show Description
syIs393 [unc-47p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP +  pBlueScript].  unc-47 cGAL driver for GABAergic neurons.  Relatively weak expression. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7167 C. elegans syIs396 syIs337 III. Show Description
syIs396 [unc-47p::NLS::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].  syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)].  syIs396 is unc-47 cGAL driver for GABAergic neurons.  syIs337 is GFP cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7169 C. elegans syIs337 syIs398 III. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)].  syIs398 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)].  syIs337 is a GFP cGAL effector. syIs398 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7171 C. elegans syIs337 III; syIs400 V. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III.  syIs400 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)] V. syIs337 is a GFP cGAL effector. syIs400 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7172 C. elegans syIs337 syIs401 III. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III. syIs401 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)].  syIs337 is a GFP cGAL effector. syIs401 is hsp-16.41 cGAL driver for heat shock promoter. Low levels of GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7185 C. elegans syIs406 IV. Show Description
syIs406 [15xUAS::?pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  GFP::H2B effector.  Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7186 C. elegans syIs407 V. Show Description
syIs407 [15xUAS::?pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  GFP::H2B cGAL effector.  Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS8083 C. elegans syEx1649. Show Description
syEx1649 [nhr-246p::GFP + unc-122p::RFP]. Pick RFP+ (coelomocytes) to maintain. Dauer decision marker that indicates commitment to dauer formation in intestine and hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS8437 C. elegans syIs599. Show Description
syIs599 [nhr-246p::GFP + unc-122p::RFP]. Pick RFP+ (coelomocytes) to maintain. Dauer decision marker that indicates commitment to dauer formation in intestine and hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS8457 C. elegans syIs601. Show Description
syIs601 [ets-10p::GFP + ofm-1p::RFP]. Dauer decision marker that indicates commitment to dauer formation in neurons and intestine. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PT2351 C. elegans him-5(e1490) V; myEx741. Show Description
myEx741 [pdfr-1p(3kb)::NLS::RFP + unc-122::GFP]. Him. Pick RFP+ and GFP+ to maintain. Reference: Barrios A, et al. Nat Neurosci. 2012 Dec;15(12):1675-82.
PY2417 C. elegans oyIs44 V. Show Description
oyIs44 [odr-1::RFP + lin-15(+)]. Bright RFP in AWB and AWC.
QQ226 C. elegans hum-1(cv21[hum-1::RFP]) I. Show Description
RFP tag inserted at C-terminus of endogenous hum-1 via CRISPR/Cas9 editing.
QU10 C. elegans izEx5. Show Description
izEx5 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Pick RFP+/GFP+ animals to maintain. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.
QU11 C. elegans glp-1(e2141ts) III; izEx5. Show Description
izEx5 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Maintain at 15C or 20C. Sterile at 25C. Pick RFP+/GFP+ animals to maintain. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.
QU13 C. elegans glp-1(bn18) III; izEx5. Show Description
izEx5 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Maintain at 15C or 20C. Sterile at 25C. Pick RFP+/GFP+ animals to maintain. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.
QV65 C. elegans vsIs33 V; gpIs1. Show Description
vsIs33 [dop-3::RFP] V. gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Reference: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166.
RJP56 C. elegans egl-46(rp4) vsIs33 V; rpIs3. Show Description
rpIs3 [gcy-33p::GFP]. vsIs33 [dop-3::RFP] V. Loss of BAG neuron specification. egl-46(rp4) is a point mutation that causing a single amino acid change (C185Y) in the zinc finger domain of EGL-46; it behaves like a null for BAG specification phenotypes.
SRS230 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx230. Show Description
sraEx230 [str-2p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AWC(on) was inhibited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS278 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx278. Show Description
sraEx278 [npr-9p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS279 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx279. Show Description
sraEx279 [ttx-3p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS281 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx281. Show Description
sraEx281 [ttx-3p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS291 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx291. Show Description
sraEx291 [npr-9p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS301 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx301. Show Description
sraEx301 [str-2p::chop-2(H134R)::TagRFP + str-2p::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AWC(on) was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS306 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx306. Show Description
sraEx306 [ser-2(prom2)::chop-2(H134R)::TagRFP + ser-2(prom2)::mKO + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses mKO and TagRFP in AIY, AIZ and RME in the head, and has little response to blue light in the absence of ATR. In the presence of ATR asymmetrical stimulation of AIY causes the worm to turn in the same direction the head was bent when AIY was excited, whereas asymmetrical stimulation of AIZ or RME causes the worm to turn in the opposite direction to which the head was bent when AIZ or RME was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS329 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx329. Show Description
sraEx329 [odr-2(18)p::chop-2(H134R)::TagRFP + odr-2(18)p::mKO + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses mKO and TagRFP in SMB in the head, and has little response to blue light in the absence of ATR. In the presence of ATR asymmetrical stimulation of SMB causes the worm to turn in the same direction the head was bent when SMB was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
TG4094 C. elegans unc-119(ed3) III; cxTi10816 IV; otIs433 V; gtEx4094. Show Description
otIs433 [dat-1::NLS::RFP + ttx-3::mCherry] V. gtEx4094 [glit-1p::GFP::glit-1 3'UTR + myo-3p::mCherry]. Pick animals with red fluorescence in body muscles to maintain. Transcriptional glit-1 reporter. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067.
TU6276 C. elegans uIs115; kuIs70. Show Description
uIs115 [mec-17p::RFP]. kuIs70 [alr-1p::GFP + rol-6(su1006)]. Rollers. PVM neurons are marked with RFP, allowing FACS sorting by subtraction: FACS sort red cells only to exclude exclude other neurons that are marked with either GFP or both RFP & GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
TV775 C. elegans wyIs58 III. Show Description
wyIs58 [opt-3::GFP::RAB-3 + unc-122p::RFP] III. Reference: Wang J, et al. Science. 2010 Jul 16;329(5989):293.
UTR133 C. elegans narSi2 II; mpk-1(ga117) III; narEx29. Show Description
narSi2 [mex-5p::GFP::mpk-1B + unc-119(+)] II. narEx29 [sur-5p::GFP::mpk-1A + myo-3p::RFP]. mpk-1(-) strain with germline MPK-1B rescued by single-copy insertion and somatic MPK-1A rescued by an extrachromosomal array. Pick RFP+ to maintain; narEx29 rescues mpk-1 so array should be stable. Transgene uses codon-optimized version of GFP. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
VC370 C. elegans rfp-1(ok572)/eT1 III; +/eT1 V. Show Description
R05D3.4. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok572 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4098 C. elegans hrpk-1(gk5045[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I. Show Description
Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VK2757 C. elegans vkEx2757. Show Description
vkEx2757 [nhx-2p::CemNeptune2.5 + myo-2p::RFP]. Wild-type animals expressing CemNeptune2.5 under the intestinal-specific nhx-2 promoter. Free CemNeptune2.5 is localized to the cytosol. Pick animals with RFP+ pharynx to maintain. Reference: Thomas
VP596 C. elegans dvIs19 III; vsIs33 V. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. vsIs33 [dop-3::RFP] V. References: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166. Leung CK, et al. J Vis Exp. 2011 May 19;(51).
VS10 C. elegans hjIs37. Show Description
hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. mRFP targeted to peroxisomes in intestinal cells. Reference: Zhang et al., PNAS (2010) 107(10):4640-5.