Search Strains

hpEx3508 [ges-1p::daf-16a,d&f + myo-2p::RFP]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. ges-1 promoter drives expression DAF-16A,D&F transgene in intestine. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.

hpSi38 [flp-14(+) + NeoR]. Superficially wild-type. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant phenotype. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782

hpIs675 [rgef-1p::GCaMP6s::3xNLS::mNeptune + lin-15(+)]. Worms express GCaMP6s and mNeptune in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446

Gonadal enlargement and aberrant gonad migration. Phenotype evident at 25C.

Maintain at 20C or lower. The cec-4 cec-5 double mutant exhibits partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-4 and CEC-5 are phylogenetically similar to CEC-8. ok3124 is a 374-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-4 (F32E10.2). The ok3124 deletion can be detected by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj58 is a 398-bp deletion located in the gene region corresponding to the N-terminus of CEC-5 (F32E10.6). The fj58 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.

No apparent phenotype. The chromodomain protein CEC-8 is phylogenetically similar to CEC-5 and CEC-4. fj63 is a 14-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-8 (Y55B1BR.3). The fj63 deletion can be detected by PCR with the following primers: GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj67) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Intracellular localization of CSR-1 is abnormal in the csr-1(fj67) homozygotes. fj67 is a 60-bp in-frame deletion of the first lysine-rich region (KQKDNFILLDILLKQWAAKK) in CSR-1. The first lysine-rich region in the WT has a FokI site. The deletion can be checked by PCR with the following primers: CACCTGTGATTTTTCGGGGAAC and TGGATTCCTTTTGCTGCAACAG, followed by digestion with FokI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj70) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj70 is a D769L mutation that renders CSR-1 (an Argonaute protein) catalytically defective and generates a new SphI site. The fj70 mutation can be checked by PCR with the following primers: TACACGTGGATGATGAGAAG and TCGTCCGAAACTTCCTCATC, followed by digestion with SphI. Homozygous nT1[qIs51] inviable. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj126) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj126 was generated by the insertion of a synthetic nuclear export signal (NES). Instead of six amino-acid residues (R8–I13) near the N-terminus of CSR-1b, an NES sequence (LNELALKLAGLDI) from the cAMP-dependent protein kinase inhibitor alpha in mammals was inserted into the endogenous csr-1 gene. The DNA sequence encoding the NES has a HindIII site. The fj126 mutation can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and CCGCTGAGGAACGAGATGG, followed by digestion with HindIII. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the him-1(e879) mutant is enhanced by the CeRep55_X quadruple deletions. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. The e879 mutation can be checked by PCR with the following primers: AAATCAGGAGTGGGCATCAG and GGGAAGATTCCGATGAGTGA, followed by digestion with MvaI. The wild-type him-1 gene contains an MvaI site within its PCR region, while the e879 allele does not. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

fj162 at the second K-rich region is an in-frame duplication (comprising of a small duplication and a tiny inverted duplication) generating 61 extra amino acids. The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the csr-1(fj162) mutant is enhanced by the CeRep55_X quadruple deletions. The fj162 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Pick wild-type Venus+ animals to maintain. coh-4(tm1857) coh-3(gk112) homozygotes exhibit defects in synaptonemal complex formation on meiotic chromosomes. Many of the progeny from coh-4 coh-3 homozygotes exhibit embryonic lethality, likely due to aneuploidy, but only a few progeny hatch and exhibit the Him phenotype. The coh-3 and coh-4 genes encode nearly identical meiosis-specific kleisins. The deletion mutations can be checked by PCR with the following primers: coh-4(tm1857): TACGCGGCACACATGGGTCT and CAATTCCCCCTAGACATACGATTC; coh-3(gk112): CTCGCAGCGATCGAGCAAGC and AACTGAACATGAGAGCCACGAAG. tmC16 homozygotes are Unc Venus(+). [NOTE: ZT73 with the inversion-based balancer is more amenable to producing coh-4 coh-3 homozygous mutant males than TY5120 with a translocation-based balancer.] Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

zwIs132 [myo-3p::GCamp2 + lin-15(+)]. Transgenic animals are GFP+ in body wall muscle. Maintain under normal conditions. Reference: Liu P, et al. J Physiol. 2011 Jan 1;589(Pt 1):101-17.

aipr-1(zw86) is a hypomorphic loss-of-function allele caused by a G-to-A transition in the splice acceptor site preceding the final exon. Mutants display hyperactive locomotion, increased mEPSC frequency/amplitude and eEPSC amplitude at the NMJ, and elevated motor neuron Ca2+ transients. Increased ER Ca2+ leak is consistent with loss of AIPR-1 stabilization of UNC-68/ryanodine receptor. To verify zw86 lesion, the authors recommend use PCR primers Sense: TCGGGTTACTGTAGTGGTCGG / Antisense: TGATTTTGGAATGTACATAGATG to generate a 748 bp product for subsequent DNA sequencing. Reference: Chen B, et al. Nat Commun. 2017;8(1):1380. DOI: 10.1038/s41467-017-01704-z. PMID: 29123133.

zxEx32 [myo-3p::NpHR + myo-3p::ChR2(H134R)::YFP + lin-15(+)].

zxEx33 [unc-17p::NpHR::eCFP + lin-15(+)].

zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter (see also ZX679). When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. This strain is in lite-1(ce314) background, which eliminates the photophobic behavioral response that will be startled by blue light when longer light stimuli are used (>1s). To not confuse the photophobic behavior induced by LITE-1, with the PVD evoked escape behavior, this strain is needed for experiments with prolonged photostimulation. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.

Pseudowild levamisole resistance. Head more resistant than body. Body resistance is temperature sensitive. WT phenotype.

Pseudo wild type levamisole resistance. WT phenotype.

Pseudo wild type levamisole resistant. WT phenotype. pka lev-10.

tanEx483 [C-terminal SL2::cGAL TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::GFP + snt-1p::HisCl1::SL2::GFP + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal co-expression tagging with SL2::cGAL. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx488 [C-terminal GFP-C1 TAG-IN dornor plasmid with SEC LoxP + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal fusion tagging with GFP-C1. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx490 [C-terminal mCherry TAG-IN donor plasmid with SEC Lox2272 + myo-2p::HisCl1::SL2::GFP + snt-1p::HisCl1::SL2::GFP + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal fusion tagging with GFP-C1. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx492 [C-terminal SL2::rTetR(DBD) TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I +snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal co-expression tagging with SL2::rTetR(DBD). Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx494 [C-terminal SL2::tTA(tet OFF,DBD) TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal co-expression tagging with SL2::tTA. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx496 [C-terminal SL2-lexA(DBD) TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal co-expression tagging with SL2::lexA(DBD). Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx498 [C-terminal SL2::QF(DBD) TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal co-expression tagging with SL2::QF(DBD). Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx500 [C-terminal SL2::QF2(DBD) TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal co-expression tagging with SL2::QF2(DBD). Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx502 [C-terminal mNeongreen TAG-IN donor plasmid with SEC LoxP + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal fusion tagging with mNeongreen. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx506 [C-terminal TagBFP-C1 TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal fusion tagging with TagBFP-C1. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx508 [C-terminal 7xGFP11 TAG-IN donor plasmid with SEC LoxP + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal fusion tagging with 7xGFP11. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx510 [C-terminal mIAA7::eGFP TAG-IN donor plasmid with SEC LoxP + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal fusion tagging with mIAA7::eGFP. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx512 [C-terminal mIAA7::mCherry TAG-IN donor plasmid with SEC Lox2272 + myo-2p::HisCl1::SL2::GFP + snt-1p::HisCl1::SL2::GFP + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal fusion tagging with mIAA7::mCherry. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx514 [C-terminal AID TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal fusion tagging with AID. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx516 [C-terminal ZF1-GFP TAG-IN donor plasmid with SEC LoxP + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal fusion tagging with ZF1-GFP. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx518 [C-terminal 3xHA TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal fusion tagging with 3xHA. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx520 [C-terminal 3xFLAG TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal fusion tagging with 3xFLAG. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx524 [C-terminal Dendra2 TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal fusion tagging with 3xHA turboID. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx524 [C-terminal Dendra2 TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal fusion tagging with Dendra2. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx526 [C-terminal KillerRed TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for C-terminal fusion tagging with KillerRed. Maintain the array at RT or 25C by picking surviving Rollers. The postive selection marker SEC within the TAG-IN donor plasmid confers Rol and hygR phenotypes to animals carrying the array. In the presence of histamine, HisCl1 provides negative selectionagainst the array during TAG-IN swapping via RMCE through genetic crossing. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx528 [N-terminal cGAL::SL2 TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::GFP + snt-1p::HisCl1::SL2::GFP + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for N-terminal co-expression tagging with cGAL::SL2. Maintain at 20-25C and pick Rollers to select animals retaining the SEC. The SEC in the TAG-IN donor plasmid provides postive selection markers Rol and HygR. In the presence of histamine, HisCl1 provides negative selection against the array during TAG-IN swapping via genetic crossing. Use heat shock after swapping into a seed allele to remove SEC (as described in Dickinson et al. 2015) to obtain the final TAG-IN allele. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx530 [N-terminal rTetR::SL2 TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for N-terminal co-expression tagging with rTetR::SL2. Maintain at 20-25C and pick Rollers to select animals retaining the SEC. The SEC in the TAG-IN donor plasmid provides postive selection markers Rol and HygR. In the presence of histamine, HisCl1 provides negative selection against the array during TAG-IN swapping via genetic crossing. Use heat shock after swapping into a seed allele to remove SEC (as described in Dickinson et al. 2015) to obtain the final TAG-IN allele. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx532 [N-terminal tTA(tet OFF)::SL2 TAG-IN donor plasmid with SEC(Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for N-terminal co-expression tagging with tTA(tet OFF)::SL2. Maintain at 20-25C and pick Rollers to select animals retaining the SEC. The SEC in the TAG-IN donor plasmid provides postive selection markers Rol and HygR. In the presence of histamine, HisCl1 provides negative selection against the array during TAG-IN swapping via genetic crossing. Use heat shock after swapping into a seed allele to remove SEC (as described in Dickinson et al. 2015) to obtain the final TAG-IN allele. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx536 [N-terminal QF::SL2 TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for N-terminal co-expression tagging with lexA::SL2. Maintain at 20-25C and pick Rollers to select animals retaining the SEC. The SEC in the TAG-IN donor plasmid provides postive selection markers Rol and HygR. In the presence of histamine, HisCl1 provides negative selection against the array during TAG-IN swapping via genetic crossing. Use heat shock after swapping into a seed allele to remove SEC (as described in Dickinson et al. 2015) to obtain the final TAG-IN allele. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx536 [N-terminal QF::SL2 TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for N-terminal co-expression tagging with QF::SL2. Maintain at 20-25C and pick Rollers to select animals retaining the SEC. The SEC in the TAG-IN donor plasmid provides postive selection markers Rol and HygR. In the presence of histamine, HisCl1 provides negative selection against the array during TAG-IN swapping via genetic crossing. Use heat shock after swapping into a seed allele to remove SEC (as described in Dickinson et al. 2015) to obtain the final TAG-IN allele. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx539 [N-terminal QF2::SL2 TAG-IN donor plasmid with SEC Lox511I + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet-I + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for N-terminal co-expression tagging with QF2::SL2. Maintain at 20-25C and pick Rollers to select animals retaining the SEC. The SEC in the TAG-IN donor plasmid provides postive selection markers Rol and HygR. In the presence of histamine, HisCl1 provides negative selection against the array during TAG-IN swapping via genetic crossing. Use heat shock after swapping into a seed allele to remove SEC (as described in Dickinson et al. 2015) to obtain the final TAG-IN allele. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx540 [N-terminal GFP-C1 TAG-IN donor plasmid with SEC LoxP + myo-2p::HisCl1::SL2::mScarlet-I + snt-1p::HisCl1::SL2::mScarlet + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for N-terminal fusion tagging with GFP-C1. Maintain at 20-25C and pick Rollers to select animals retaining the SEC. The SEC in the TAG-IN donor plasmid provides postive selection markers Rol and HygR. In the presence of histamine, HisCl1 provides negative selection against the array during TAG-IN swapping via genetic crossing. Use heat shock after swapping into a seed allele to remove SEC (as described in Dickinson et al. 2015) to obtain the final TAG-IN allele. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006

tanEx542 [N-terminal mCherry TAG-IN donor plasmid with SEC Lox2272 + myo-2p::HisCl1::SL2::GFP + snt-1p::HisCl1::SL2::GFP + pha-1(+) + pBlueScript KS(+)]. TAG-IN donor strain for N-terminal fusion tagging with mCherry. Maintain at 20-25C and pick Rollers to select animals retaining the SEC. The SEC in the TAG-IN donor plasmid provides postive selection markers Rol and HygR. In the presence of histamine, HisCl1 provides negative selection against the array during TAG-IN swapping via genetic crossing. Use heat shock after swapping into a seed allele to remove SEC (as described in Dickinson et al. 2015) to obtain the final TAG-IN allele. Reference: TAG-IN, a swappable strategy for endogenous gene tagging in Caenorhabditis elegans using cassette exchange. Han et al. bioRxiv 2026.01.16.700006; doi: https://doi.org/10.64898/2026.01.16.700006