Search Strains

Resistance to excess dietary zinc and nickel observed on noble agar minimal media with supplemental zinc or nickel; elevated levels of histidine observed in C. elegans on minimal media. Reference: Murphy JT, et al. PLoS Genet. 2011 Mar;7(3):e1002013.

jyIs8 [pals-5p::GFP + myo-2p::mCherry] X. virIs1 [pHIP::OrsayRNA1 + pHIP::OrsayRNA2 + myo-2p::YFP]. viro-9(vir16) is a missense mutation. Orsay virus replication defective. GFP expression induced in the intestine after intracellular infection or proteasomal inhibition.

jyIs8 [pals-5p::GFP + myo-2p::mCherry] X. virIs1 [pHIP::OrsayRNA1 + pHIP::OrsayRNA2 + myo-2p::YFP]. viro-9(vir18) is a homozygous recessive missense mutation. Orsay virus replication defective. GFP expression induced in the intestine after intracellular infection or proteasomal inhibition.

Wt. Synthetic lethal with lin-35/Rb. High % Pun in lin-35 background.

WT. Synthetic lethal with lin-35/Rb. Lower brood size than WT. High % gonad morphogenesis in lin-35 background.

Heterozygotes are WT and segregate WT and Sterile Dpys. Homozygous rib-2(qa4900) animals give homozygous F2 animals that can develop to the adult stage but exhibit abnormal phenotypes such as egg-laying defects, increased body width, and reduced activity in movement. While the F2 qa4900 homozygotes are fertile, the F3 qa4900 homozygous progeny stop developing during gastrulation and fail to develop normally. 511 bp deletion in the region of intron2 to exon 6 of the rib-2 gene (K01G5.6).

Resistant to paraquat (methyl viologen). Dyf phenotype. Extended lifespan. mev-4 = che-11.

Mutation affects locomotion, pharyngeal pumping rate, egg-laying, and causes reduction in life-span.

Heterozygotes are WT and GFP+ in the pharynx. ok487 homozygotes arrest as early larvae and are GFP-. qIs51 homozygotes are inviable.

qaEx6401 [hlh-17::GFP + rol-6(su1006)]. Maintain by picking Rollers. GFP expression in sheath cells of cephalic sensilia. Transmission frequency is about 38%.

qaEx6900 [ftn-1p::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

qaEx6902 [ftn-1p(delta63)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

Phenotypically WT. C55B7.2

Phenotypically wild type. T15D6.2

Phenotypically wild type. F44F4.6

Phenotypically WT. C55B7.2

Phenotypically wild type. F22D6.11

Superficially WT. Suppressor of gna-2. Reduced brood counts at all temperatures (very strongly reduced at 26C). Exhibits mating-dependent progressive hermaphrodite sterility. Reduced embryo survival following heat shock.

Pleiotropic defects including reduced broodsize, reduced levels of histone H3 serine 10 phosphorylation, cold-sensitive embryonic lethality, cold-sensitive early embryonic mitotic and cytokinetic defects. Reference: Lee S, et al. PLoS One. 2007 Nov 28;2(11):e1213.

qaIs8400 [let-858p::Ov-GST-3 + rol-6(su1006)]. Called AK1 in the reference article. The Ov-GST-3 gene was amplified from genomic DNA of O. volvulus with 1µM of the sequence specific primer 5'Klon and 3'Klon (5'Klon: 5'-GGCGTACGATGTCAAGATTTCCTCAACAAG-3'; 3'Klon: 5'-GGTCTAGATTTATTTAGGAATGATTGAATCGGTCG-3'; representing bases 4 - 25 and the complementary sequence of bases 821 - 841 of the published Ov-GST-3 cDNA (AF203814); bold underlines indicate restriction sites for Pfl23II (SplI) and XbaI, respectively; dotted underline indicates the start codon for translation; italics indicates the conserved sequence for the polyadenylation signal for transgenic transcript processing; the 8 5'-nucleotides of primer 3'Klon and the fourteen 5'-nucleotides of primer 5'Klon do not correspond to the template and introduce the sequences to the amplicon), 200 µM of each deoxynucleotide (Gibco BRL) and 2.5 units of Taq polymerase (Gibco BRL). After an initial denaturation of 3 minutes at 93°C, 35 cycles of annealing at 55°C for 1 minute, synthesis at 72°C for 2 minutes and a 1 minute denaturation at 93°C were performed, followed by a final extension at 72°C for 5 minutes. The genomic Ov-GST-3 fragment obtained by PCR (see above) was ligated into the pGEM-T Easy vector (Promega) by TA-cloning, cleaved with the restriction enzymes Pfl23II (SplI) and XbaI (restriction sites introduced by the primer) and inserted between the unique Pfl23II (SplI) and XbaI sites of the vector pPD103.05 (kindly provided by A. Fire). The sequence of the genomic Ov-GST-3 fragment in the resulting plasmid pAK1 was confirmed by automated dye terminator, dideoxy sequencing (ABI Prism 377TM Sequencer, PE Applied Biosystems) using the PCR primers (see above). The pAK1 DNA was injected in combination with the marker plasmid pRF4 [rol-6(su1006)] into the gonads of N2 C. elegans at a concentration of approximately 100 ng/µl for each plasmid. Transgenic worms were identified by the selectable Roller marker phenotype and the stable transmitting line AK1ex (AK1 extrachromosomal) was established. Integration of the extrachromosomal arrays was achieved by irradiation of AK1ex worms with 3600 rad (1 rad = 0.01 Gy) of x-rays (x-ray chamber: RUM 9421-070-77002, Philips, Netherlands; dosimeter: PTW-SN4, PTW, Germany). The progeny of these worms was then screened for 100% transmittance of the Roller phenotype to obtain the C. elegans line AK1int (AK1 integrated) with the chromosomally integrated transgenes.

oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. wpEx16 [unc-47p::sup-17 + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain array. GABAergic expression of SUP-17 from wpEx16 rescues sup-17(n316). Reference: El Bejjani R, Hammarlund M. Neuron. 2012; 73(2):268-78.

oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. wpEx22 [myo-3p::sup-17 + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain array. Muscular expression of SUP-17 from wpEx22 rescues sup-17(n316). Reference: El Bejjani R, Hammarlund M. Neuron. 2012; 73(2):268-78.

oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. wpEx30 [pdi-2p::sup-17 + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain array. Hypodermal expression of SUP-17 from wpEx30 rescues sup-17(n316). Reference: El Bejjani R, Hammarlund M. Neuron. 2012; 73(2):268-78.

wpIs14 [unc-17p::KillerRed + unc-122p::GFP] X. X-Linked based on out-cross data. KillerRed expression in acetylcholine neurons. KillerRed is a red fluorescent protein and photosensitizer that efficiently generates reactive oxygen species (ROS) when activated by light. Reference: Williams DC, et al. Cell Rep. 2013 Oct 31;5(2):553-63.

wpIs15 [unc-47p::KillerRed] X. Slight Unc. KillerRed is a red fluorescent protein and photosensitizer that efficiently generates reactive oxygen species (ROS) when activated by light. wpIs15 produces a Shrinker phenotype after illumination by white light for 2 hrs. Reference: Williams DC, et al. Cell Rep. 2013 Oct 31;5(2):553-63.

juIs76 [unc-25p::GFP + lin-15(+)] II. GFP expression in GABAergic motor neurons. wpIs15 [unc-47p::KillerRed] X. Slight Unc. KillerRed is a red fluorescent protein and photosensitizer that efficiently generates reactive oxygen species (ROS) when activated by light. wpIs15 produces a Shrinker phenotype after illumination by white light for 2 hrs. Reference: Williams DC, et al. Cell Rep. 2013 Oct 31;5(2):553-63.

wpEx76 [myo-3p::tom20::tdKillerRed + unc-122p::GFP]. Pick GFP+ to maintain. KillerRed is a red fluorescent protein and photosensitizer that efficiently generates reactive oxygen species (ROS) when activated by light. wpEx76 carries a tandem dimer version of KillerRed targeted to the mitochondria by the addition of a tom-20 targeting sequence (mito-tdKillerRed). Reference: Williams DC, et al. Cell Rep. 2013 Oct 31;5(2):553-63.

wpEx146 [dat-1p::MYR::tdKillerRed + dat-1p::GFP]. Pick GFP+ to maintain. KillerRed expression in acetylcholine neurons. KillerRed is a red fluorescent protein and photosensitizer that efficiently generates reactive oxygen species (ROS) when activated by light. wpEx146 carries a tandem dimer version of KillerRed targeted to the plasma membrane through the addition of a myristoylation tag (mry-tdKillerRed). Reference: Williams DC, et al. Cell Rep. 2013 Oct 31;5(2):553-63.

wpIs59 [unc-47p::MYR::tdKillerRed]. KillerRed is a red fluorescent protein and photosensitizer that efficiently generates reactive oxygen species (ROS) when activated by light. wpIs59 carries a tandem dimer version of KillerRed targeted to the plasma membrane through the addition of a myristoylation tag (mry-tdKillerRed). Reference: Williams DC, et al. Cell Rep. 2013 Oct 31;5(2):553-63.

wp78 is a CRISPR/Cas9-engineered 11.5 kb deletion removing the entire coding region of casy-1, the C. elegans homolog of calsyntenin. casy-1(wp78) phenocopies the casy-1(wp60) point mutation and strongly suppresses PVQ degeneration in both ric-7(n2657) and miro-1(wy50180); mtx-2(wy50266) mutants. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.

ccIs4595 [ceh-24::GFP + rol-6(su1006)]. wpEx482 [ceh-17::NLS::TagRFP + pha-1(+)]. Maintain at 25C to retain array. GFP expression in vulval muscles, m8, and set of neurons in the head. The four SIA neurons are marked with both GFP and RFP. Can be used to isolate SIA by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

wpEx505 [ocr-3p::mEGFP + pha-1(+)]. Maintain at 23-25C to select for array. PVP neurons are marked with mEGFP. Can be used to isolate PVP by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). The ocr-3p::mEGFP plasmid used to generate this strain was provided by Dr. Patrick Laurent.

wpEx517 [srab-20p::Neptune2.5 + pha-1(+)]. Maintain at 25C to select for animals carrying the array. Neptune2.5 expression in PHB neuron can be used to isolate PHB by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otIs707 [bnc-1p(1.8kb)::GFP]. wpEx525 [nlp-38p::NLS::TagRFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. GFP expression in VA neurons can be used to isolate VA by FACS (exclude TagRFP). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

Heterozygotes are Unc with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous unc-43(n498); fog-3(q443) animals are females.

Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.

qxIs750 [hsp-16.2p::nuc-1::pHTomato::unc-54 3'UTR + hsp-16.41p::nuc-1::pHTomato::unc-54 3'UTR + odr-1p::GFP]. Heat-shock inducible pHTomato transgene for monitoring lysosomal activity. Reference: Sun Y, et al. Elife. 2020 Jun 2:9:e55745. doi: 10.7554/eLife.55745. PMID: 32482227.

yakEx126 [unc-17p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from cholinergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx126 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx131 [eft-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from a ubiquitous promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx131 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx137 [unc-14p::hif-1(P621A)::YFP + myo-2p::mCherry]. Pick animals with red pharynx to maintain. Non-degradable form of HIF-1 tagged with YFP expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx137 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx136 [vha-6p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from intestine-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx136 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx142 [unc-14p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. unc-14 promoter drives GFP expression in several tissues including neurons, intestine, muscle, hypodermis. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx143 [dpy-7p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from a hypodermal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx143 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx144 [unc-14p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx144 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx145 [unc-47p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from GABA-ergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx145 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx125 [rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx125 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx146 [vha-6p::hif-1(cDNA) + dpy-7p::hif-1(cDNA) + rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-, hypodermal-, and intestinal-specific promoters in hif-1 mutant background for tissue-specific rescuing experiments. yakEx146 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2421 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok2421 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3294 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok3294 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm2868 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. tm2868 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.