hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. Transgenic animals have pharyngeal RFP expression and SNB-1::GFP expression in AVA (soma and along the VNC).

hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4081 [rig-3p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre + myo-2p::RFP]. Pick RFP+ (pharynx) to maintain. Transgenic animals are GFP and RFP positive in multiple neurons in the head, but strong RFP signals in AVA neurite. Superficially wild type. Activation of gtACR2 decreases AVA and AVB’s calcium signals. hpEx4081 can be maintained by picking animals with weak pharyngeal RFP signals (seems to be a common artifact of the Cre-LoxP system).

hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. hpIs811 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::Cherry + twk-40p(short)::Cre]. Transgenic animals have pharyngeal RFP signal; GFP puncta are visible in AVA soma but not along the VNC; RFP signals along AVA neurite.

hpEx4363 [npr-4p::ins-22::pHluorin + myo-2p::wCherry]. Pick wCherry+ (pharynx) animals to maintain.

hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. hpEx4363 [npr-4p::ins-22::pHluorin + myo-2p::wCherry]. Pick wCherry+ (pharynx) animals to maintain. Red fluorescence in AVA.

hpEx4362 [flp-18p::cha-1(sense) + twk-40p::cha-1(antisense) + ttx-3p::GFP]. Pick animals with GFP expression in AIY to maintain. Transgenic animals exhibit reduced forward speed and body bending; this phenotype is not fully penetrate.

hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40p(short)::Cre + myo-2p::wCherry]. hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. RFP positive in AVA soma and neurite along the VNC. Weak pharyngeal RFP. Flat and slow movement without ATR or LED stimulation. Chrimson activation induces loopy reversal but not loopy forward after 5min.

hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(bln336) is a gain-of-function allele. Paralyzed; no backward movement upon head touch. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with weaker expression than in a wild-type background.

hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(hp834) is a loss-of-function allele. Loopy. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background.

hpIs636 [rig-3p::HisCl1::SL2::mCherry]. hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. Synapse exocytosis marker in AVA. Transgenic animals exhibit punctate green fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background. mCherry and HisCl1 expression in AVA soma and neurites. In the presence of histamine, the SNB-1::pHluorin intensity will decrease in neurites.

hpIs66 [nab-1::GFP]. Reporter contains nab-1 genomic clone with 9 kb promoter sequence upstream of ATG, the entire nab-1 gene with GFP inserted immediately before the stop codon, and the 1 kb downstream sequence. Animals are slightly short with malformed tail in hermaphrodites. GFP localized in puncta at synapses in nerve cords and nerve ring. GFP localization also along the excretory canals, and some vulva expression. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.

Uncoordinated behaviour. Fainter, pauses quickly after stimulating touch-response by prodding or tapping plate. References: Humphry JA, et al. Curr Biol. 2007 Apr 3;17(7):624-9. Gao S, et al. Nat Commun. 2015 Feb 26;6:6323.

hp684(Q1864X) mutant animals generate reversal movement with little flexing of the posterior body, and the stiffness is prominent during prolonged reversals. This phenotype is progressive, and most prominent when animals develop from the L4 stage larvae into adults. Reference: Chitturi JH, et al. PLoS Genetics. 2018;14(4):e1007303.

hpEx3371 [rgef-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.

hpEx3370 [dpy-30p::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic strain expressing DAF-16A isoform from pan-tissue dpy-30 promoter. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.

hpEx3373 [ges-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.

hpEx3507 [ges-1p::GFP::daf-16d/f::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.

hpEx3508 [ges-1p::daf-16a,d&f + myo-2p::RFP]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. ges-1 promoter drives expression DAF-16A,D&F transgene in intestine. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.

hpSi38 [flp-14(+) + NeoR]. Superficially wild-type. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant phenotype. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782

hpIs675 [rgef-1p::GCaMP6s::3xNLS::mNeptune + lin-15(+)]. Worms express GCaMP6s and mNeptune in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446

Gonadal enlargement and aberrant gonad migration. Phenotype evident at 25C.

Maintain at 20C or lower. The cec-4 cec-5 double mutant exhibits partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-4 and CEC-5 are phylogenetically similar to CEC-8. ok3124 is a 374-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-4 (F32E10.2). The ok3124 deletion can be detected by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj58 is a 398-bp deletion located in the gene region corresponding to the N-terminus of CEC-5 (F32E10.6). The fj58 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.

No apparent phenotype. The chromodomain protein CEC-8 is phylogenetically similar to CEC-5 and CEC-4. fj63 is a 14-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-8 (Y55B1BR.3). The fj63 deletion can be detected by PCR with the following primers: GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj67) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Intracellular localization of CSR-1 is abnormal in the csr-1(fj67) homozygotes. fj67 is a 60-bp in-frame deletion of the first lysine-rich region (KQKDNFILLDILLKQWAAKK) in CSR-1. The first lysine-rich region in the WT has a FokI site. The deletion can be checked by PCR with the following primers: CACCTGTGATTTTTCGGGGAAC and TGGATTCCTTTTGCTGCAACAG, followed by digestion with FokI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj70) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj70 is a D769L mutation that renders CSR-1 (an Argonaute protein) catalytically defective and generates a new SphI site. The fj70 mutation can be checked by PCR with the following primers: TACACGTGGATGATGAGAAG and TCGTCCGAAACTTCCTCATC, followed by digestion with SphI. Homozygous nT1[qIs51] inviable. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj126) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj126 was generated by the insertion of a synthetic nuclear export signal (NES). Instead of six amino-acid residues (R8–I13) near the N-terminus of CSR-1b, an NES sequence (LNELALKLAGLDI) from the cAMP-dependent protein kinase inhibitor alpha in mammals was inserted into the endogenous csr-1 gene. The DNA sequence encoding the NES has a HindIII site. The fj126 mutation can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and CCGCTGAGGAACGAGATGG, followed by digestion with HindIII. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the him-1(e879) mutant is enhanced by the CeRep55_X quadruple deletions. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. The e879 mutation can be checked by PCR with the following primers: AAATCAGGAGTGGGCATCAG and GGGAAGATTCCGATGAGTGA, followed by digestion with MvaI. The wild-type him-1 gene contains an MvaI site within its PCR region, while the e879 allele does not. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

fj162 at the second K-rich region is an in-frame duplication (comprising of a small duplication and a tiny inverted duplication) generating 61 extra amino acids. The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the csr-1(fj162) mutant is enhanced by the CeRep55_X quadruple deletions. The fj162 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Pick wild-type Venus+ animals to maintain. coh-4(tm1857) coh-3(gk112) homozygotes exhibit defects in synaptonemal complex formation on meiotic chromosomes. Many of the progeny from coh-4 coh-3 homozygotes exhibit embryonic lethality, likely due to aneuploidy, but only a few progeny hatch and exhibit the Him phenotype. The coh-3 and coh-4 genes encode nearly identical meiosis-specific kleisins. The deletion mutations can be checked by PCR with the following primers: coh-4(tm1857): TACGCGGCACACATGGGTCT and CAATTCCCCCTAGACATACGATTC; coh-3(gk112): CTCGCAGCGATCGAGCAAGC and AACTGAACATGAGAGCCACGAAG. tmC16 homozygotes are Unc Venus(+). [NOTE: ZT73 with the inversion-based balancer is more amenable to producing coh-4 coh-3 homozygous mutant males than TY5120 with a translocation-based balancer.] Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

zwIs132 [myo-3p::GCamp2 + lin-15(+)]. Transgenic animals are GFP+ in body wall muscle. Maintain under normal conditions. Reference: Liu P, et al. J Physiol. 2011 Jan 1;589(Pt 1):101-17.

zxEx32 [myo-3p::NpHR + myo-3p::ChR2(H134R)::YFP + lin-15(+)].

zxEx33 [unc-17p::NpHR::eCFP + lin-15(+)].

zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter (see also ZX679). When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. This strain is in lite-1(ce314) background, which eliminates the photophobic behavioral response that will be startled by blue light when longer light stimuli are used (>1s). To not confuse the photophobic behavior induced by LITE-1, with the PVD evoked escape behavior, this strain is needed for experiments with prolonged photostimulation. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.

Pseudowild levamisole resistance. Head more resistant than body. Body resistance is temperature sensitive. WT phenotype.

Pseudo wild type levamisole resistance. WT phenotype.

Pseudo wild type levamisole resistant. WT phenotype. pka lev-10.