More Fields
Strain Species Genotype
BRC566 C. elegans antIs31 II; unc-119(ed9) III. Show Description
antIs31 [attP-f + Cbr-unc-119(ant40) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. Unc. antIS31 has been found to self-excise; check for GFP expression periodically to retain the insertion. GFP expression in pharynx is very weak (as it is in single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. antIs31 was derived by CRISPR/Cas9 knockout of Cbr-unc-119 in antIs30 creating ant40, a 691 bp deletion in Cbr-unc-119. Because antIs31 does not rescue unc-119(ed3), BRC566 facilitates the use of Unc-119 rescue as a selection marker for transgene insertions. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.
BS3383 C. elegans pmk-3(ok169). Show Description
F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.
BS3493 C. elegans gld-3(ok308)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok308 homozygotes (mostly sterile or Mel, but can be slowly propagated at 20C). Pick WT dim GFP and check for correct segregation of progeny to maintain.
BS518 C. elegans ozDf1/sdc-3(y52y180) unc-76(e911) V. Show Description
Heterozygotes are slow growing with WT phenotype. Hets segregate more slow growing WT, embryonic lethals (ozDf1/ozDf1) and DpyUncs which are sick and have a maternal effect lethal (none of the offspring from the DpyUncs survive to reproduce). Maintain by picking WT.
BS5351 C. elegans nos-2(ok230) nos-1(gv5)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nos-2 nos-1 homozygotes (segregate many dead embryos). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. Reference: Hansen D, et al. Development. 2004 Jan;131(1):93-104.
BS5431 C. elegans prp-17(oz273) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
BS5435 C. elegans prp-17(oz273) I/hT2 (I;III); glp-1(oz264) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
glp-1(oz264) is a gain-of-function allele. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273; oz264 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
BS585 C. elegans unc-13(e51) ozDf5 I; nDp4 (I;V)/+. Show Description
Strain gives WT hermaphrodites and dead eggs.
BW1434 C. elegans dpy-17(e164) III; him-8(e1489) IV; her-1(y101hv1) unc-42(e270) V; ctDp11 (III;V;f). Show Description
Wild type hermaphrodites and males which produce WT, Dpy, Unc and DpyUnc progeny due to mating or loss of the duplication. Pick WT hermaphrodites and males to maintain.
BW1561 C. elegans dpy-18(e364) nob-1(ct223) unc-25(e156) III; eDp6 (III;f). Show Description
Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain. The Dpy and Unc phenotypes are not visible in the Nob background. ct223 is recessive.
BW1563 C. elegans pal-1(ct281)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct281 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct281 is a 4.7kb deletion removing intron 5, exon 6, and the 3'UTR of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BW1566 C. elegans pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BW1634 C. elegans nob-1(ct223)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
WT hermaphrodites that segregate WT, Dpy Steriles and Nob larvae. The Nob phenotype results in 100% lethality. Maintain by picking WT.
BW1850 C. briggsae Cbr-him(s1290). Show Description
C. briggsae strain. Hermaphrodites are variably self-sterile, which is overcome by mating to males of the same genotype. From BC1991.
BW1927 C. elegans pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III; ctIs33. Show Description
ctIs33 [pal-1::GFP + rol-6(su1006)]. Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. ctIs33 carries a non-rescuing pal-1::GFP fusion containing ~7kb 5' of the SL1 splice site through part of exon 5 fused to GFP. GFP expression is primarily embryonic and limited to a few cells; not visible except at high magnification. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BW2041 C. elegans pal-1(ct224) dpy-17(e164) ncl-1(e1865) unc-36(e251) III; svDp1 (III;f). Show Description
svDp1 [sur-5::GFP] (III;f). svDp1 was derived by insertion of a sur-5::GFP marker into sDp3(III;f). Pick GFP+ wild-type to maintain. svDp1 rescues ct224. ct224 homozygotes (lacking GFP expression) show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. The duplication is lost in about 30-40% of embryos. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BW287 Panagrolaimus sp. Show Description
Chinese rhabditis hermaphrodite nematode from Bill Wood's Chinese collection, Beijing. According to David Fitch this strain is Panagrolaimus sp. April 2008: According to sequence data from Howe & Denver 2008 BMC Evol Biol 8:62, strain BW287 is C. briggsae.
BZ142 C. elegans slo-1(eg142) V. Show Description
Head-bending phenotype. Maintain under normal conditions. Reference: Kim, H et al. (2009) PLoS Genetics 5(12):31000780.
BZ28 C. elegans snf-6(eg28) III. Show Description
Head-bending phenotype. Maintain under normal conditions. Reference: Kim, H et al. (2004) Nature 430:891-6.
BZ33 C. elegans dys-1(eg33) I. Show Description
Head-bending phenotype. Maintain under normal conditions. Reference: Kim, H et al. (2004) Nature 430:891-6.
BZ978 C. elegans islo-1(eg978) IV. Show Description
Head-bending phenotype. Maintain under normal conditions. Reference: Kim, H et al. (2009) PLoS Genetics 5(12):31000780.
CA1208 C. elegans ieSi60 II; unc-119(ed3) III. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in pharyngeal muscle. This strain can be used for auxin-inducible degradation (AID) in pharyngeal muscle. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1212 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I; ieSi60 II. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in pharyngeal muscle. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in pharyngeal muscle, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1218 C. elegans syp-3(ok758) I; ieSi11 II; unc-119(ed3) III. Show Description
ieSi11 [syp-3p::EmeraldGFP::syp-3::syp-3 3'UTR + Cbr-unc-119(+)] II. ieSi11 was inserted into ttTi5605 II using MosSCI. Expression of GFP::SYP-3 largely complements syp-3(ok758), but some meiotic nondisjunction is detected above the N2 background (85% embryonic viability; ~1% male self-progeny;). GFP::SYP-3 expression is readily detected in spermatocytes and oocytes in the germline, and localizes to the interface between paired homologous chromosomes during most of meiotic prophase. Reference: Rog O, Dernburg AF. Cell Rep. 2015 Mar 10. pii: S2211-1247(15)00178-3.
CA1219 C. elegans unc-119(ed3) III; ieSi21 IV. Show Description
ieSi21 [sun-1p::sun-1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. ieSi21 was inserted into cxTi10882 IV using MosSCI. Expression of the transgenic SUN-1::mRuby fusion protein complements the sun-1 deletion allele. SUN-1::mRuby is expressed throughout the germline and in the early embryo, where it localizes to nuclear envelope and associates with chromosome pairing centers during early meiotic prophase. Reference: Rog O, Dernburg AF. Cell Rep. 2015 Mar 10. pii: S2211-1247(15)00178-3.
CA538 C. elegans rad-51(lg8701)/mIs11 IV. Show Description
mIs11 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in the pharynx. mIs11 homozygotes are WT with bright GFP in the pharynx. rad-51(lg8701) homozygotes are non-GFP and throw dead eggs. Pick WT with dim GFP+ in pharynx to maintain. mIs11 homozygotes will quickly overtake the population if not selected against.
CA998 C. elegans ieDf2 [unc-119+]/mIs11 IV. Show Description
mIs11 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP]. Heterozygotes are wild-type with dim GFP signal in the pharynx. mIs11 homozygotes are wild-type with bright GFP in the pharynx. ieDf2 homozygotes (non-GFP) develop normally but produce 97.5% inviable embryos and a high frequency of males among the surviving self-progeny. Pick WT with dim GFP+ in pharynx to maintain. mIs11 homozygotes will quickly overtake the population if not selected against. GFP expression in 4-cell embryos, pharyngeal muscle and gut. ieDf2 is a deficiency of zim-1, zim-2, zim-3, and him-8 generated by MosDel, resulting in single-copy insertion of a copy of the C. briggsae unc-119 gene on Chromosome IV. The deletion spans the sequences from the beginning of the zim-1 coding sequence through the ttTi22866 Mos1 insertion site.
CB1033 C. elegans che-2(e1033) X. Show Description
Chemotaxis abnormal. Amphid defect-EM. M-MATING-NO SUCCESS
CB1091 C. elegans unc-13(e1091) I. Show Description
Unc-paralysed, kinky, small, irregular pharyngeal pumping. Suppressed by sup-5 and sup-7.
CB1180 C. elegans dpy-11(e1180) V. Show Description
Piggy phenotype (severe Dpy). Growth slow. Poor viability.
CB1196 C. elegans unc-26(e1196) IV. Show Description
Unc-severe kinker. Small. Scrawny. Flaccid. Little movement. Slow pharyngeal pumping.
CB1255 C. elegans vab-11(e1255) IV. Show Description
Blebs on tail of adult hermaphrodite. Tail irregular, tail cuticle sometimes separated, tail spike sometimes truncated. Some animals have enlarged excretory canals.
CB1315 C. elegans unc-54(e1315) I. Show Description
Paralyzed Unc. Severe phenotype. Recessive. Null allele.
CB1378 C. elegans che-3(e1378) I. Show Description
Dauer defective. Not leaky. Crowds. Amphid defect by EM. M-MATING-NO SUCCESS.
CB1386 C. elegans daf-5(e1386) II. Show Description
Dauer defective. WT phenotype. M-MATING+++ 10-30%WT.
CB1387 C. elegans daf-10(e1387) IV. Show Description
Amphid defect. Chemotaxis defective (Na+). Crowds. Dauer defective. Very leaky. M-MATING+POOR <1%WT.
CB1421 C. elegans unc-52(e1421) II. Show Description
Dystrophic body muscle. Weak allele.
CB1518 C. elegans her-1(e1518) V. Show Description
XX animals are WT. XO animals are fertile hermaphrodites.
CB1561 C. elegans her-1(e1561) V. Show Description
WT appearance. XO fertile hermaphrodites. Temperature sensitive.
CB1600 C. elegans tra-2(f70) II. Show Description
Transforms XX to males. Variable expression. Masculinized self-fertile hermaphrodite. tra-2(f70) was crossed into the N2 background to construct a dpy-10 tra-2 unc-4 triple mutant, then crossed to remove the flanking dpy and unc (Jonathan Hodgkin).
CB2317 C. elegans tra-2(e1425) II; sup-5(e1464) III. Show Description
tra-2 suppressed. Viable hermaphrodite. See also CGC 397. Grow between 22.5C and 24C.
CB2318 C. elegans sup-5(e1464) III; tra-3(e1107) IV. Show Description
tra-3 suppressed. Viable hermaphrodite. See also CGC 397.
CB2590 C. elegans tra-1(e1099)/dpy-18(e1096) III. Show Description
Heterozygotes are wild-type, and segregate wild-type heterozygotes, fertile wild-type males (tra-1 homozygotes), and Dpy. Can recombine: pick individual WT hermaphrodites and check for correct segregation of progeny to maintain.
CB2597 C. elegans tra-2(e1098)/dpy-10(e128) unc-4(e120) II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and males. Maintain by picking WT hermaphrodites.
CB2612 C. elegans tra-3(e1107)/dpy-4(e1166) IV. Show Description
Maternal effect tra-3. Heterozygotes are WT and segregate WT and Dpy. Homozygous tra-3 animals are WT hermaphrodites which segregate abnormal sterile males or intersex.
CB2810 C. elegans tra-1(e1575)/+ III; unc-42(e270) him-5(e1490) dpy-21(e428) V. Show Description
Pick Unc hermaphrodite to maintain (these will be tra-1/+; unc-42 him-5 dpy-21 XO animals). Segregates Unc hermaphrodites (tra-1/+ III), Unc males (+/+ III), and DpyUnc hermaphrodites (+/+ III). dpy-21 not expressed in XO. dpy-21(e428) V; XX animals are weak Dpy. dpy-21(e428) V; XO animals are non-Dpy.
CB2823 C. elegans tra-1(e1488) III; eDp6 (III;f). Show Description
Balanced well. Animals with the duplication are WT. Animals which have lost the duplication have a hermaphrodite gonad and intestine (they are self-fertile); the rest of the body is male.
CB2842 C. elegans unc-58(e665e2112) X. Show Description
Intragenic revertant of dominant mutation e665. Slight uncoordinated phenotype.
CB3060 C. elegans sup-9(n180) II; unc-93(e1500) III. Show Description
Recessive Suppressor. XO Fertile hermaphrodite. WT phenotype.
CB3221 C. elegans him-2(e1065) I; mab-8(e1250) II. Show Description
Hermaphrodites are nearly WT. Vulva slightly swollen. Males have abnormal swollen bursae. M-MATING++ 1-10%WT.