JVR406 |
C.elegans |
jerEx30. Show Description
jerEx30 [ddr-2p::BiFC1 (EGFH1-LINK-SYN) + tph-1p::BIFC2 (SYN-EGFH2) + rol-6(su1006)]. Pick Rollers to maintain. a-Synuclein BiFC transfer strain is a model to investigate neuron-to-neuron ?-syn transfer. Reference: Tyson T, et al. Sci Rep. 2017 Aug 8;7(1):7506.
|
|
JY190 |
C. elegans |
osm-9(yz6) IV. Show Description
Downregulation of tph-1::GFP expression in the ADF neurons. CORRECTION: The yz6 allele had been erroneously listed as y26 in our database.
|
|
JY243 |
C. elegans |
ocr-2(yz5) IV. Show Description
Downregulation of tph-1::GFP expression in the ADF neurons.
|
|
JY359 |
C. elegans |
lim-4(yz12) X. Show Description
Down regulation of tph-1::GFP expression in the ADF neurons.
|
|
KWN190 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; rnyEx109. Show Description
rnyEx109 [nhx-2p::D3cpv + pha-1(+)]. Maintain at 20-25C to select for array. KWN190 strain expresses the FRET-based calcium indicator protein D3cpv throughout the cytoplasm of intestinal cells. Dual emission ratio imaging (ex. 435, em. 480/535-nm) can be used to measure intestinal calcium and, although the FRET pair is CFP/YFP, intestinal D3cpv fluorescence is observable under standard GFP filter sets. The D3cpv biosensor has the advantages of being relatively pH-insensitive and not interfering with endogenous calmodulin signaling. References: Am J Physiol Cell Physiol. 301:C1389-1403. Am J Physiol Cell Physiol. 297:C1071-81. FASEB J. 27:760-768. PLoS Biol. 11: e1001613.
|
|
KWN26 |
C. elegans |
pha-1(e2123) III; rnyEx6. Show Description
rnyEx6 [nhx-2p::pHluorin + pha-1(+)]. Maintain at 20-25C to select for array. KWN26 strain expresses the pH-sensitive GFP variant pHluorin throughout the cytoplasm of intestinal cells. Dual excitation ratio imaging (ex. 410/470, em. 435-nm) can be used to measure intestinal pH and intestinal pHluorin fluorescence is observable under standard GFP filter sets. References: J Biol Chem 278:44657-44666. Curr Biol. 18: 297-302. Am J Physiol Cell Physiol. 297:C1071-81. Am J Physiol Cell Physiol.302 C1045-1054.
|
|
LP193 |
C. elegans |
cpIs56 II; unc-119(ed3) III. Show Description
cpIs56 [mex-5p::TagRFP-T::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.
|
|
LP306 |
C. elegans |
cpIs53 II; unc-119(ed3) III. Show Description
cpIs53 [mex-5p::GFP-C1::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.
|
|
LP307 |
C. elegans |
cpIs54 II; unc-119(ed3) III. Show Description
cpIs54 [mex-5p::mKate::PLC(delta)-PH(A735T)::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.
|
|
LP308 |
C. elegans |
cpIs55 II; unc-119(ed3) III. Show Description
cpIs55 [mex-5p::mCherry-C1::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.
|
|
LP402 |
C. elegans |
cpIs64 II; unc-119(ed3) III. Show Description
cpIs64 [mex-5p::mYPet::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.
|
|
LX837 |
C. elegans |
vsIs45. Show Description
vsIs45 [tph-1::GFP]. tph-1::GFP in vsIs45 is expressed exclusively in the NSM neurons in larvae and NSM + HSN in adults, whereas other tph-1::GFP reporters are also expressed in other serotonergic neurons; can be used to image NSM development and for FACS isolation of NSM from L1s. Reference: Nelson JC, Colon-Ramos DA. J Neurosci. 2013 Jan 23;33(4):1366-76.
|
|
LX960 |
C. elegans |
lin-15B&lin-15A(n765) X; vsIs97. Show Description
vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab].
|
|
LX967 |
C. elegans |
lin-15B&lin-15A(n765) vsIs103 X. Show Description
vsIs103 [tph-1p::RFP + snb-1::GFP + lin-15(+)] X. RFP expression in HSN and NSM neurons.
|
|
LX975 |
C. elegans |
vsIs13 IV; lin-15B&lin-15A(n765) X; vsIs97; vsIs100. Show Description
vsIs13 [pes-10p::GFP + lin-15(+) IV. GFP expression in six VC neurons and posterior intestine. vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab]. vsIs100 [myo-3p::CFP + lin-15(+)]. CFP expression in VMs. Additional background expression seen as punctate nucleolar fluorescence along the ventral side of the worm (also present in wild-type).
|
|
LX993 |
C. elegans |
lin-15B&lin-15A(n765) X; vsIs108. Show Description
vsIs108 [tph-1p::RFP + unc-13::GFP + lin-15(+)] X. RFP expression in HSN and NSM neurons.
|
|
MG617 |
C. elegans |
xsSi5 II. Show Description
xsSi5 [pie-1p::GFP::ani-1(AH+PH)::pie-1 3'UTR + Cbr-unc-119(+)] II. The RhoA biosensor consists of GFP fused to the C-terminal portion of C. elegans anillin, which contain its conserved region (AH) and pleckstrin homology (PH) domain. It lacks the N-terminal myosin- and actin-binding domains but retains its RhoA-binding domain. [NOTE: xsSi5 was originally published as mgSi5.] References: Tse YC, et al. Mol Biol Cell. 2012 Oct;23(20):4020-31.
|
|
MH2230 |
C. elegans |
dph-3(ku432) . Show Description
Superficially wild type. Maintain under standard conditions. Reference: Kims S, et al. Genetics. 2010 Aug;185(4):1235-47.
|
|
MLC2465 |
C. elegans |
oxIs322 II; unc-119(ed3) III; lucEx1311. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. lucEx1311 (myo-3p::R2pH::LAMP1::3xFLAG::unc-54 3UTR + ttx-3p::mCherry). Pick mCherry+ to maintain. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
MT14984 |
C. elegans |
tph-1(n4622) II. Show Description
Egl. Reduced pharyngeal pumping.
|
|
MT15434 |
C. elegans |
tph-1(mg280) II. Show Description
Backcrossed tph-1(mg280) allele. cam-1 mutation was removed by crossing left and right of tph-1(mg280) using bli-2 and unc-4. Strain does not have withered tail defect and moves well.
|
|
NA22 |
Escherichia coli |
E. coli. Show Description
Bacteria. Jim Lewis received this E. coli strain from Henry Epstein in 1977. It is a prototroph and the worms grow well on it in liquid, even when the bacteria are highly labeled with 35-S. It hasn't been tested to see if it is temperature sensitive. It should be distributed as "Jim Lewis' NA22" until it has been confirmed that this is a certified version of NA22. Biosafety Level: BSL-1.
|
|
NC3182 |
C. elegans |
otIs181 III; otIs138 X; otIs396. Show Description
otIs181[dat-1::mCherry + ttx-3::mCherry] III. otIs138[ser-2(prom3)::GFP + rol-6(su1006)] X. otIs396 [ace-1prom2::NLS::tagRFP]. Rollers. dat-1::mCherry labels ADE, CEP, and PDE neurons. ttx3::mCherry labels AIY neurons. ser-2(prom3)::GFP labels OLL, PDE, and PVD neurons.
ace-1prom2::NLS::tagRFP labels CEP and OLL neurons. PVD can be identified by expression only GFP. An additional pair of GFP-only cells anterior to OLL are occasionally observed in this strain. Can be used to isolate PVD by FACS (green-only). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). Reference: Barbara OBrien (2017) Diverse genetic and transcriptional programs mediate dendritic development of a nociceptor neuron. Ph.D Dissertation, Vanderbilt University. (https://ir.vanderbilt.edu/handle/1803/14489?show=full)
|
|
NFB1720 |
C. elegans |
tph-1(vlc46[tph-1::T2A::mNeonGreen]) II. Show Description
mNeonGreen tag inserted into endogenous tph-1 locus. Upstream flanking sequence: CTCTCCGCTCAGACATCAACCTGCTCGCCGGAGCTCTCCACTACATCCTG. Downstream flanking sequence: TAGTTTGAGTTTCCGTGTTTTTTATTTTTTTTATTTGGTTTCTGCTTTCT. Guide sequence: GTAGTTTGAGTTTCCGTGTT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB2468 |
C. elegans |
zdIs13 IV; vlcEx1288. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1A(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1A. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB2471 |
C. elegans |
zdIs13 IV; vlcEx1290. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB509 |
C. elegans |
zdIs13 IV; vlcEx284. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx284 [hsp-16.2p::hlh-3 + ttx-3::mCherry + rol-6(su10006)]. Rollers. Extrachromosomal array containing the heat shock responsive hsp-16.2 promoter for time controlled expression of hlh-3 transcription factor cDNA. Transcriptional tph-1 GFP reporter labels the serotonergic system. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
NJF01 |
Escherichia coli |
NJF01 (F-, lambda- lysA0::Tn10 IN(rrnD-rrnE)1, DE3, (delta)rnc-38). Show Description
Bacteria. NJF01 originates from E. coli ET505 (F-, lambda- lysA0::Tn10 IN(rrnD-rrnE)1), modified with DE3 and (delta)rnc-38. The E. coli is lysine auxotroph and resistant to kanamycin and tetracycline. IPTG induces expression of the T7 polymerase. Grow at 37 °C on LA plates or in LB liquid medium. Reference: Fredens J, et al. Nat Methods. 2011 Aug 28;8(10):845-7.
|
|
NK2115 |
C. elegans |
cpIs121 I; rrf-3(pk1426) II; rde-1(ne219) V. Show Description
cpIs121 [lag-2p::mNG::PH::F2A::rde-1] I. Temperature-sensitive: maintain at 16-20C. RNAi-response variant. RNAi-hypersensitized DTC-specific RNAi strain that labels all rde-1(+) cells with mNeonGreen. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284.
|
|
OC271 |
C. elegans |
pph-4.1(tm1598) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1598 homozygotes (produce ~100% dead eggs, slightly higher penetrance at 25C). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Peters N, et al., J Cell Sci. 2010 Mar 1;123(Pt 5):795-805.
|
|
OCF15 |
C. elegans |
unc-119(ed3); ocfIs2. Show Description
ocfIs2 [pie-1p:mCherry::sp12::pie-1 3'UTR + unc-119(+)]. Stable germline and embryonic expression of ER and NE marker, useful for following NE dynamics through early development. Reference: Joseph-Strauss D, et al. Dev Biol. 2012 May 15;365(2):445-57.
|
|
OCF22 |
C. elegans |
unc-119(ed3) III; ocfIs5. Show Description
ocfIs5 [pie-1p::mCherry::npp-1::pie-1 3'UTR + unc119(+)]. Reference: Joseph-Strauss D, et al. Dev Biol. 2012 May 15;365(2):445-57.
|
|
OD58 |
C. elegans |
unc-119(ed3) III; ltIs38. Show Description
ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)].
|
|
OD70 |
C. elegans |
unc-119(ed3) III; ltIs44 V. Show Description
ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)].
|
|
OD73 |
C. elegans |
unc-119(ed3) III; ltIs38; ltIs24. Show Description
ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. ltIs24 [pAZ132; pie-1::GFP::tba-2 + unc-119(+)].
|
|
OD95 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; ltIs38. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: McNally et al., JCB (2006).
|
|
OG528 |
C. elegans |
hsf-1(sy441) I; drSi12 II. Show Description
drSi12 [hsf-1p::human hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy human HSF1 (drSi12) in hsf-1(sy441) hypomorph. drSi12 includes human hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the C. elegans hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
|
|
OG532 |
C. elegans |
hsf-1(sy441) I; drSi13 II. Show Description
drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy C. elegans HSF-1 (drSi13) in hsf-1(sy441) hypomorph. drSi13 includes hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Moderate rescue of sy441 25C growth arrest, but should be maintained at 20C or lower. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
|
|
OG580 |
C. elegans |
hsf-1(sy441) I; drSi28 II. Show Description
drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in hsf-1(sy441) hypomorph. drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain, with a C-terminal GFP and under control of 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
|
|
OG646 |
C. elegans |
hsf-1(sy441) I; drSi41 II. Show Description
drSi41 [hsf-1p::hsf-1::HA::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi41 in hsf-1(sy441) hypomorph. drSi41 includes hsf-1 cDNA containing an HA tag in frame between amino acids 370 and 371, under control of 4 kb of the hsf-1 promoter, integrated as a single copy by MosSCI on chromosome II at ttTi5605. Moderate rescue of sy441 25C growth arrest, but should be maintained at 20C or lower. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
|
|
OH12495 |
C. elegans |
otIs517. Show Description
otIs517 [tph-1(fosmid)::SL2::YFP::H2B + ttx-3::mCherry]. Fosmid-based tph-1 reporter expresses YFP in NSM, ADF, and HSN neurons, as well as in R1B, R3B, and R9B (in males). Adult animals roll, though for reasons unknown.
|
|
OH4127 |
C. elegans |
zdIs13 IV; oyIs14 V; wrk-1(ok695) X. Show Description
zdIs13 [tph-1p::GFP] IV. oyIs14 [sra-6::GFP + lin-15(+)] V.
|
|
OH4134 |
C. elegans |
otIs173 III; zdIs13 IV. Show Description
otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP] III. zdIs13 [tph-1p::GFP] IV.
|
|
OH4135 |
C. elegans |
otIs173 III; zdIs13 IV; wrk-1(ok695) X. Show Description
otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP]. zdIs13 [tph-1p::GFP] IV.
|
|
OH4138 |
C. elegans |
zdIs13 IV; wrk-1(tm1099) X. Show Description
zdIs13 [tph-1p::GFP] IV.
|
|
OH4143 |
C. elegans |
vab-1(dx31) II; zdIs13 IV. Show Description
zdIs13 [tph-1p::GFP] IV.
|
|
OH4144 |
C. elegans |
vab-1(dx31) II; zdIs13 IV; wrk-1(ok695) X. Show Description
zdIs13 [tph-1p::GFP] IV.
|
|
OH4147 |
C. elegans |
zdIs13 IV; wrk-1(ok695) X. Show Description
zdIs13 [tph-1p::GFP] IV.
|
|
OH7235 |
C. elegans |
zdIs13 IV; otEx3154. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3154 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 1.
|
|
OH7236 |
C. elegans |
zdIs13 IV; otEx3155. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3155 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 2.
|
|