More Fields
Strain Species Genotype
TMD67 C. elegans mikSi1 II; ltIs38. Show Description
mikSi1 [sas-4p::dendra2::sas-4] inserted into ttTi5605 II. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Photoconvertable tagged SAS-4 protein. Reference: Erpf AC & Mikeladze-Dvali T. (2020). Tracking of centriole inheritance in C. elegans. microPublication Biology. 10.17912/micropub.biology.000256.
UDN100161 C. elegans pph-5(udn91) V. Show Description
pph-5 [A48T] #2 variant edit from Fielder, et al. (2022). Includes addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and superficially wild-type. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested.
UDN100163 C. elegans pph-5(udn93) V. Show Description
pph-5 [A48A] #1 control edit for strain UDN100160 from Fielder, et al. (2022). Wild-type sequence except for addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and wild-type appearance. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested.
VC164 C. elegans swd-3.1 dph-1(ok329) III. Show Description
C14B1.4, C14B1.5. Slow-growing, small broods. Deletion removes 3' end of C14B1.4, 5' end of C14B1.5. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2286 C. elegans jph-1(ok2823) I. Show Description
T22C1.7. External left primer: TGGAATGTGTGGTTGAAGGA. External right primer: GGTGATCCCTCTGGCTGTAA. Internal left primer: TTGTGAATTGATTGGTGTTTGA. Internal right primer: GGCCTTTCTGGTAGAGGAGG. Internal WT amplicon: 1144 bp. Deletion size: 637 bp. Deletion left flank: TTCGGCATCACATGATTGTGATACGCTTTT. Deletion right flank: AATTTCAAAAATTTCCCTCATAATTTCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3479 C. elegans aph-2(gk3380)I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
aph-2. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2950 homozygotes (arrest stage not determined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGAAGTGGAGATAGGTGGG. External right primer: TGTTTCAGAACAGCGACCTG. Internal left primer: ATTCCGAGTGTCGTTTTTCG. Internal right primer: CCATTTAAAGGCGCAAACAT. Internal WT amplicon: 1456 bp. Deletion size: 426 bp. Left flanking sequence: AAAGAAACATTGAATGTGAAAAGTGAAAAG. Right flanking sequence: GAGTTTCGCATTAAAGAAAACTAGATTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4473 C. elegans maph-1.3(gk5546[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4864 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAGTTGAAAATGAAAAAAATCCACCCATC. Right flanking sequence: ATGGGGTGTGCCCGACAAAAATGGGGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4576 C. elegans maph-1.1(gk5647[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 4814 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTTATTCATTTTGATATGTGTCTCTAGGCA. Right flanking sequence: GAATGCTCTTCAAAATCACTATTTTTAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC956 C. elegans sph-1(ok1466) IV. Show Description
F42G8.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VH4 C. elegans rhIs4 III; zag-1(rh315) IV. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. Hypomorph. Unc. Axon outgrowth defects and misexpression of glr-1::GFP marker.
VH7066 C. elegans pph-1(hd7066[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2500 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTATTTTTTCGTTTTCAAAAAATAGTACCG; Right flanking sequence: CTGTCCCGGGTCCTTTCTTTTCTCCCGATT. sgRNA #1: CCTAGGTATTTTTGTTTTCT; sgRNA #2: CCCTTCAAACCATCACTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
WF1131 C. elegans cam-1(gm105) II. Show Description
cam-1 hypomorph. Grows best at 15C.
X1666 Escherichia coli E. coli. Show Description
Bacteria. E. coli. Plasmidless, NAL-resistant, ARA-minus, Good growth, high density. Uracil prototroph. Biosafety Level: BSL-1.
XA792 C. elegans sup-46(qa707) I. Show Description
Superficially WT. Suppressor of gna-2. Reduced brood counts at all temperatures (strongly reduced at 26C). Reduced embryo survival following heat shock. Hypomorph.
AA1 C. elegans daf-12(rh257) X. Show Description
daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele. Occasional abnormal dauers under exhausted conditions.
AA10 C. elegans daf-12(rh286) X. Show Description
Weak heterochronic phenotypes in seam, intestine, somatic gonad. Class V allele.
AA107 C. elegans nhr-48(ok178) X. Show Description
ZK662.3 Homozygous. No obvious phenotype. Outer left primer sequence: TCTGAAGTTTGTGAGCCGTG. Outer right primer sequence: AGCGCCTAGATGAGCAACAT. Inner left primer sequence: TCCGTTGAATGCCATCTGTA. Inner right primer sequence: GGACGATGCACATGAGTTTG. Inner primer PCR product length: 3324 bp. Deletion size: 1956 bp.
AA18 C. elegans daf-12(rh61rh412) X. Show Description
daf-d. Weak heterochronic phenotypes in seam, somatic gonad and intestine. Class III allele.
AA278 C. elegans dhIs59. Show Description
dhIs59 [Topo::daf-9::GFP + lin-15(+)]. Perinuclear expression in a ventral pair of bilateral neurons identified as the IL1Vs or URAVs in the anterior ganglia. By mid-L2, expression in the cytoplasm of the hypodermis, the syncitial epidermis, but absent from midline, epidermal seam cells. Levels peak around the L2 molt and diminish during L4. In some cases, transient expression seen in the L3 vulval blast cells. Also expressed within the hermaphrodite spermatheca starting in late L4 larvae and continuing eve in old adults. In males, expression in IL1V/URAVs and hypodermis but not somatic gonad. In dauer larvae, strong expression in IL1V/URAV and specifically extends into axonal but not dendritic processes. In post-dauer stages, expression in a pattern similar to reproductively growing animals, except expression is absent in the hypodermis. Grow at 20C. May still contain lin-15(n765) mutation in the background.
AA34 C. elegans daf-12(rh61) X. Show Description
daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele.
AA6 C. elegans daf-12(rh84) X. Show Description
daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele.
AA699 C. elegans din-1(hd36) II. Show Description
non-Daf. Temperature-sensitive phenotypes: at 20C half of the animals are egg-laying defective with occasional mispositioned gonadal arms; at 25C, 18% arrest as embryos: those animals that hatch usually display variable morphology defects in body and pharynx; nearly all animals that live to adults are small, clear, slightly uncoordinated, constipated, and virtually sterile. Maintain at 20C or below.
AA790 C. elegans lin-15B&lin-15A(n765) X; dhEx343. Show Description
dhEx343 [din-1p::din-1E::GFP + lin-15(+)]. Pick GFP+ to maintain. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1s::GFP is detected in hypodermis, seam, intestine, and somatic gonad including the distal tip cells. din-1s is also expressed in neurons, vulval precursors, body wall muscle, pharynx, and all tissues with heterochronic phenotypes or remodeled during dauer. Expression is first detected in a few nuclei by the comma stage of embryogenesis. By hatching, din-1s was widely expressed, albeit weakly. Overall expression in most tissues is detected at various levels into adult and in dauer larvae. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1p::din-1E::GFP was produced by cloning into Fire Lab vector L3781.
AA82 C. elegans daf-12(rh284) X. Show Description
Gonadal lead cell Mig. Weak heterochronic phenotype in intestine. Weakly daf-c at 25C. Class V allele.
AA83 C. elegans daf-12(rh62rh157) X. Show Description
daf-d. Strong heterochronic phenotypes in seam and intestine. Weak heterochronic phenotypes in somatic gonad. Class II allele.
AA85 C. elegans daf-12(rh285) X. Show Description
Strong heterochronic phenotypes in seam, somatic gonad, and intestine. Weakly daf-c at 15C. Class IV allele.
AA86 C. elegans daf-12(rh61rh411) X. Show Description
Daf-d, weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.
AA87 C. elegans daf-12(rh273) X. Show Description
Daf-c, gonadal Mig, weak heterochronic phenotypes in intestine and seam. Class VI allele.
AA88 C. elegans daf-12(rh193) X. Show Description
Strong heterochronic phenotypes in seam, somatic gonad, and intestine. Heterochronic phenotypes less penetrant at 15C. Weakly daf-c at 25C. Class IV allele.
AA89 C. elegans daf-12(rh274) X. Show Description
daf-c. Gonadal Mig. Weak heterochronic phenotypes in intestine. Class VI allele.
ABR1 C. elegans pha-1(e2123) III; staEx1. Show Description
staEx1 [T20F7.6p + pha-1(+)]. Empty vector control strain. Maintain at 25 degrees. Superficially wild-type. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.
ABR156 C. briggsae Cbr-she-1(v35) IV; mfIs42. Show Description
mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.
ABR4 C. elegans pha-1(e2123) III; staEx4. Show Description
staEx4 [T20F7.6p(R81Q)::T20F7.6 + pha-1(+)]. Constitutively active T20f7.6 promoter construct (CA3). Maintain at 25 degrees. Superficially wild-type with increased lifespan and stress resistance. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.
AC257 C. elegans ppk-3(n2668) X. Show Description
Growth retardation, enlarged vacuoles (late endosomes and lysosomes) in intestine, epidermis, coelomocytes and pharynx. 27% embryonic lethality and 8% post-embryonic lethality.
AD213 C. elegans spe-19(eb52) V; asEx83. Show Description
asEx83 [spe-19(+) + myo-3p::GFP]. Pick GFP+ to maintain. asEx83 contains 7.3kb genomic fragment including spe-19 (Y113G7A.10) and 850bp of upstream sequence. Transgene rescues spe-19(eb52) sperm activation defect. GFP+ hermaphrodites are fertile. non-GFP hermaphrodites are sterile. All males are fertile.
AD226 C. elegans egg-3(tm1191)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP tm1191 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain.
AD266 C. elegans egg-4(tm1508) egg-5(ok1781) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1508 ok1781 homozygotes (maternal sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Parry JM, et al 2009 Current Biology 19(20):1752-7.
AD281 C. elegans spe-45(as38) IV; him-5(e1490) V. Show Description
Him. Temperature-sensitive sterile. Small brood size even at permissive temperatures; pick fertile animals and maintain at 15C. Worms lacking spe-45 function produce morphologically normal and motile sperm that cannot fuse with oocytes despite direct contact in the reproductive tract. spe-45 hermaphrodites and males are subfertile at 16C and sterile at 25C. Reference: Singaravelu G, et al. Current Biology 2015. http://dx.doi.org/10.1016/j.cub.2015.10.055
AD292 C. elegans spe-51(as39) IV; him-5(e1490) V; asEx95. Show Description
asEx95 [T22B11.1(genomic) + myo-3p::GFP]. Pick GFP+ animals to maintain. as39 is a non-conditional allele of spe-51. Mutant hermaphrodites and males are severely subfertile due to a sperm defect. The extrachromosomal array asEx95 effectively rescues the fertility defect. Him. Reference: Mei X, et al. Curr Biol. 2023 Jul 3;S0960-9822(23)00780-7. doi: 10.1016/j.cub.2023.06.029. PMID: 37453427.
ADS1002 C. elegans aeaIs10. Show Description
aeaIs10 [rgef-1p::GCaMP6s::3xNLS + lin-15(+)]. Worms express GCaMP6s in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446
ADS707 C. elegans unc-13(s69) I; aeaIs8; hpIs728. Show Description
aeaIs8 [ift-20p::GCaMP6s::3xNLS + lin-15(+)]. hpIs728 [gpc-1p::wCherry + lin-15(+)]. Unc. Nuclear-localized GCaMP6s expressed in ciliated sensory neurons. Cytoplasmic wCherry expression in a subset of neurons. Derived by crossing EG9631 (unc-13) hermaphrodites with ZM10104 (aeaIs8; hpIs728) heterozygous males. Reference: Lin A, et al. bioRxiv 2022.05.27.493772; doi: https://doi.org/10.1101/2022.05.27.493772.
AE501 C. elegans nhr-8(ok186) IV. Show Description
Approx. 1.3 kb deletion - does not remove entire coding region, might not be null allele. No overt morphological or behavioral abnormalities. Homozygotes are 2-3X more sensitive to colchicine and chloroquine than are N2 animals.
AF13(4) Oscheius akosreti Oscheius akosreti wild isolate. Show Description
Isolated in Memorial Park in Madison, WI. No hermaphrodites. Lots of SDS resistant dauers. Can survive between 15-28C, but grows very slowly at 15C.
AF72 Mesorhabditis spiculigera Show Description
Mesorhabditis spiculigera. Isolated in Pennsylvania. NOTE: (06/10/2016) AF72 was originally described as Mesorhabditis miotki, but K. Kiontke has determined through morphological inspection that this is actually a strain of Mesorhabditis spiculigera.
AF8130 Pristionchus sp. Show Description
Neodiplogasteridae: Pristionchus Iheritieri, Maupas, 1919. Isolated in Ontario, Canada. [9/98: Ralf Sommer has found this strain to be hermaphroditic. He had successful matings between AF8130 and PS312 Pristionchus pacificus, indicating that AF8130 is probably P. pacificus.]
AFS205 C. elegans zen-4(cle5) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
AFS222 C. elegans zen-4(cle10) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle10), GAC to AAC (D520N), and two silent mutations. One silent mutation is a CGA to CGG mutation at codon 523 that creates a recognition site for a Cas9 guide RNA, in order to use zen-4(cle10ts) as a CRISPR/Cas9 co-conversion marker. The other silent mutation is a GCA to GCT mutation at codon 519 that introduces an AluI site for RFLP analysis. Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
AG151 C. elegans cdc-25.1(nr2036)/dpy-5(e61) unc-13(e450) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and adult steriles. Original deletion from Axys Pharmaceuticals.
AG247 C. elegans tyms-1(tm2429) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm2429 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).
AG248 C. elegans mus-101(tm1761) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm1761 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).