zdIs13 [tph-1p::GFP] IV. otEx3156 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 3.

zdIs13 [tph-1p::GFP] IV. otEx3163 [unc-120p::hif-1(p621A) + ttx-3::RFP]. Line 1.

zdIs13 [tph-1p::GFP] IV. otEx3165 [unc-120p::hif-1(p621A) + ttx-3::RFP]. Line 3.

zdIs13 [tph-1p::GFP] IV. otEx3168 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 1.

zdIs13 [tph-1p::GFP] IV. otEx3169 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 2.

zdIs13 [tph-1p::GFP] IV. otEx3170 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 3.

zdIs13 [tph-1p::GFP] IV. otEx3567 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 1.

zdIs13 [tph-1p::GFP] IV. otEx3568 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 2.

zdIs13 [tph-1p::GFP] IV. otEx3569 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 3.

Bacteria. Uracil auxotroph. E. coli B. Biosafety Level: BSL-1.

Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.

GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.

F42G8.10 Heterozygotes are WT and GFP+. Outer Left Sequence: aaagtgaacagcaggccaac. Outer Right Sequence: attgtccatcccatcgaaga. Inner Left Sequence: aggaaaccatggctttaggc. Inner Right Sequence: gcttgtgctttcgactttcc. Inner Primer PCR Length: 2101. Estimated Deletion Size: about 1350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

foxEx3 [rgef-1p::tomm-20::Rosella]. Pick animals with red fluorescence in in neurons to maintain. foxEx3 expresses neuron-specific, mitochondrial localized Rosella, a pH-sensitive fluorescent biosensor for monitoring and analyzing mitophagy. Reference: Cummins N, EMBO J. 2019 Feb 1;38(3):e99360. PMID: 30538104

zdIs13 [tph-1p::GFP] IV. Transcriptional tph-1 reporter. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Clark SG & Chiu C. Development. 2003 Aug;130(16):3781-94.

Hypomorph. Dpy. Hypodermal protrusions.

ncEx3090 [tph-1p::Arch::eGFP + (pCFJ90) myo-2p::mCherry]. Pick GFP+mCherry+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.

hrtSi28 [des-2p::mKate2::maph-1.1 + unc-119(+)] IV. hrtSi28 inserted into cxTi10882. Expression of mKate2::MAPH-1.1 microtubule marker in PVD and FLP. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

heIs63 [wrt-2p::GFP::PH + wrt-2p::GFP::H2B + lin-48p::mCherry] V. GFP expression in seam cells and mCherry expression in pharynx. Reference: Wildwater M, et al. Development. 2011 Oct;138(20):4375-85.

he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II. e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Superficially wild-type. CRISPR/Cas9 was used to create insertion alleles he314 and he259 insertions into N2 background at sites of known MosSCI insertions ttTi5605 and cxTi10816, respectively. ePDZ–LOV system transgenes allow use of blue light to control protein heterodimerization, in this case, membrane recruitment of ePDZ-tagged proteins of interest. Germline-optimized cytosolic ePDZ::mCherry-tagged SMU-1 (GLO-ePDZ::mCherry::SMU-1), and membrane-bound LOV2 domain fused to a pleckstrin-homology domain (PH::eGFP::LOV). Reference: Fielmich LE, et al. eLife 2018 Aug 15;7:e38198. doi: 10.7554/eLife.38198.

mikSi1 [sas-4p::dendra2::sas-4] inserted into ttTi5605 II. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Photoconvertable tagged SAS-4 protein. Reference: Erpf AC & Mikeladze-Dvali T. (2020). Tracking of centriole inheritance in C. elegans. microPublication Biology. 10.17912/micropub.biology.000256.

pph-5 [A48T] #2 variant edit from Fielder, et al. (2022). Includes addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and superficially wild-type. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested.

pph-5 [A48A] #1 control edit for strain UDN100160 from Fielder, et al. (2022). Wild-type sequence except for addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and wild-type appearance. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested.

C14B1.4, C14B1.5. Slow-growing, small broods. Deletion removes 3' end of C14B1.4, 5' end of C14B1.5. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22C1.7. External left primer: TGGAATGTGTGGTTGAAGGA. External right primer: GGTGATCCCTCTGGCTGTAA. Internal left primer: TTGTGAATTGATTGGTGTTTGA. Internal right primer: GGCCTTTCTGGTAGAGGAGG. Internal WT amplicon: 1144 bp. Deletion size: 637 bp. Deletion left flank: TTCGGCATCACATGATTGTGATACGCTTTT. Deletion right flank: AATTTCAAAAATTTCCCTCATAATTTCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

aph-2. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2950 homozygotes (arrest stage not determined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGAAGTGGAGATAGGTGGG. External right primer: TGTTTCAGAACAGCGACCTG. Internal left primer: ATTCCGAGTGTCGTTTTTCG. Internal right primer: CCATTTAAAGGCGCAAACAT. Internal WT amplicon: 1456 bp. Deletion size: 426 bp. Left flanking sequence: AAAGAAACATTGAATGTGAAAAGTGAAAAG. Right flanking sequence: GAGTTTCGCATTAAAGAAAACTAGATTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4864 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAGTTGAAAATGAAAAAAATCCACCCATC. Right flanking sequence: ATGGGGTGTGCCCGACAAAAATGGGGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4814 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTTATTCATTTTGATATGTGTCTCTAGGCA. Right flanking sequence: GAATGCTCTTCAAAATCACTATTTTTAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F42G8.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

rhIs4 [glr-1p::GFP + dpy-20(+)] III. Hypomorph. Unc. Axon outgrowth defects and misexpression of glr-1::GFP marker.

cam-1 hypomorph. Grows best at 15C.

Bacteria. E. coli. Plasmidless, NAL-resistant, ARA-minus, Good growth, high density. Uracil prototroph. Biosafety Level: BSL-1.

Superficially WT. Suppressor of gna-2. Reduced brood counts at all temperatures (strongly reduced at 26C). Reduced embryo survival following heat shock. Hypomorph.

daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele. Occasional abnormal dauers under exhausted conditions.

Weak heterochronic phenotypes in seam, intestine, somatic gonad. Class V allele.

ZK662.3 Homozygous. No obvious phenotype. Outer left primer sequence: TCTGAAGTTTGTGAGCCGTG. Outer right primer sequence: AGCGCCTAGATGAGCAACAT. Inner left primer sequence: TCCGTTGAATGCCATCTGTA. Inner right primer sequence: GGACGATGCACATGAGTTTG. Inner primer PCR product length: 3324 bp. Deletion size: 1956 bp.

daf-d. Weak heterochronic phenotypes in seam, somatic gonad and intestine. Class III allele.

dhIs59 [Topo::daf-9::GFP + lin-15(+)]. Perinuclear expression in a ventral pair of bilateral neurons identified as the IL1Vs or URAVs in the anterior ganglia. By mid-L2, expression in the cytoplasm of the hypodermis, the syncitial epidermis, but absent from midline, epidermal seam cells. Levels peak around the L2 molt and diminish during L4. In some cases, transient expression seen in the L3 vulval blast cells. Also expressed within the hermaphrodite spermatheca starting in late L4 larvae and continuing eve in old adults. In males, expression in IL1V/URAVs and hypodermis but not somatic gonad. In dauer larvae, strong expression in IL1V/URAV and specifically extends into axonal but not dendritic processes. In post-dauer stages, expression in a pattern similar to reproductively growing animals, except expression is absent in the hypodermis. Grow at 20C. May still contain lin-15(n765) mutation in the background.

daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele.

daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele.

non-Daf. Temperature-sensitive phenotypes: at 20C half of the animals are egg-laying defective with occasional mispositioned gonadal arms; at 25C, 18% arrest as embryos: those animals that hatch usually display variable morphology defects in body and pharynx; nearly all animals that live to adults are small, clear, slightly uncoordinated, constipated, and virtually sterile. Maintain at 20C or below.

dhEx343 [din-1p::din-1E::GFP + lin-15(+)]. din-1s::GFP is detected in hypodermis, seam, intestine, and somatic gonad including the distal tip cells. din-1s is also expressed in neurons, vulval precursors, body wall muscle, pharynx, and all tissues with heterochronic phenotypes or remodeled during dauer. Expression is first detected in a few nuclei by the comma stage of embryogenesis. By hatching, din-1s was widely expressed, albeit weakly. Overall expression in most tissues is detected at various levels into adult and in dauer larvae. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1p::din-1E::GFP was produced by cloning into Fire Lab vector L3781.

Gonadal lead cell Mig. Weak heterochronic phenotype in intestine. Weakly daf-c at 25C. Class V allele.

daf-d. Strong heterochronic phenotypes in seam and intestine. Weak heterochronic phenotypes in somatic gonad. Class II allele.

Strong heterochronic phenotypes in seam, somatic gonad, and intestine. Weakly daf-c at 15C. Class IV allele.

Daf-d, weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.

Daf-c, gonadal Mig, weak heterochronic phenotypes in intestine and seam. Class VI allele.

Strong heterochronic phenotypes in seam, somatic gonad, and intestine. Heterochronic phenotypes less penetrant at 15C. Weakly daf-c at 25C. Class IV allele.

daf-c. Gonadal Mig. Weak heterochronic phenotypes in intestine. Class VI allele.

staEx1 [T20F7.6p + pha-1(+)]. Empty vector control strain. Maintain at 25 degrees. Superficially wild-type. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.