More Fields
Strain Species Genotype
OG580 C. elegans hsf-1(sy441) I; drSi28 II. Show Description
drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in hsf-1(sy441) hypomorph. drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain, with a C-terminal GFP and under control of 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG646 C. elegans hsf-1(sy441) I; drSi41 II. Show Description
drSi41 [hsf-1p::hsf-1::HA::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi41 in hsf-1(sy441) hypomorph. drSi41 includes hsf-1 cDNA containing an HA tag in frame between amino acids 370 and 371, under control of 4 kb of the hsf-1 promoter, integrated as a single copy by MosSCI on chromosome II at ttTi5605. Moderate rescue of sy441 25C growth arrest, but should be maintained at 20C or lower. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OH12495 C. elegans otIs517. Show Description
otIs517 [tph-1(fosmid)::SL2::YFP::H2B + ttx-3::mCherry]. Fosmid-based tph-1 reporter expresses YFP in NSM, ADF, and HSN neurons, as well as in R1B, R3B, and R9B (in males). Adult animals roll, though for reasons unknown.
OH17582 C. elegans daf-16(ot853[daf-16::mNG::AID*]) I; otSi2 II; daf-2(e1370) III. Show Description
otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Temperature-senstive daf(c): maintain at 15C. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Constitutive dauer formation at 25 C due to daf-2(e1370). Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
OH18012 C. elegans pha-1(e2123) III; otEx7948. Show Description
otEx7948 [lgc-8p::mNeonGreen::PH::p10 + pha-1(+)]. I1 neurons are labeled with mNeonGreen. Can be used to isolate I1 neurons by FACS (green-only). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
OH19232 C. elegans daf-16(ot853[daf-16::mNG::AID*]) I; otSi2 II. Show Description
otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
OH19337 C. elegans tph-1(ot1545) II. Show Description
ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
OH19767 C. elegans otIs942 V. Show Description
otIs942 [tph-1(prom5)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. tph-1(prom5) drives expression of daf-2(DN) specifically in the NSM neurons. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
OH4127 C. elegans zdIs13 IV; oyIs14 V; wrk-1(ok695) X. Show Description
zdIs13 [tph-1p::GFP] IV. oyIs14 [sra-6::GFP + lin-15(+)] V.
OH4134 C. elegans otIs173 III; zdIs13 IV. Show Description
otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP] III. zdIs13 [tph-1p::GFP] IV.
OH4135 C. elegans otIs173 III; zdIs13 IV; wrk-1(ok695) X. Show Description
otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP]. zdIs13 [tph-1p::GFP] IV.
OH4138 C. elegans zdIs13 IV; wrk-1(tm1099) X. Show Description
zdIs13 [tph-1p::GFP] IV.
OH4143 C. elegans vab-1(dx31) II; zdIs13 IV. Show Description
zdIs13 [tph-1p::GFP] IV.
OH4144 C. elegans vab-1(dx31) II; zdIs13 IV; wrk-1(ok695) X. Show Description
zdIs13 [tph-1p::GFP] IV.
OH4147 C. elegans zdIs13 IV; wrk-1(ok695) X. Show Description
zdIs13 [tph-1p::GFP] IV.
OH7235 C. elegans zdIs13 IV; otEx3154. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3154 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 1.
OH7236 C. elegans zdIs13 IV; otEx3155. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3155 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 2.
OH7237 C. elegans zdIs13 IV; otEx3156. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3156 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 3.
OH7251 C. elegans zdIs13 IV; otEx3163. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3163 [unc-120p::hif-1(p621A) + ttx-3::RFP]. Line 1.
OH7253 C. elegans zdIs13 IV; otEx3165. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3165 [unc-120p::hif-1(p621A) + ttx-3::RFP]. Line 3.
OH7260 C. elegans zdIs13 IV; otEx3168. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3168 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 1.
OH7261 C. elegans zdIs13 IV; otEx3169. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3169 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 2.
OH7262 C. elegans zdIs13 IV; otEx3170. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3170 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 3.
OH8014 C. elegans zdIs13 IV; otEx3567. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3567 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 1.
OH8015 C. elegans zdIs13 IV; otEx3568. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3568 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 2.
OH8016 C. elegans zdIs13 IV; otEx3569. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3569 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 3.
OP50 Escherichia coli E. coli. Show Description
Bacteria. Uracil auxotroph. E. coli B. Biosafety Level: BSL-1.
PHX3596 C. elegans tph-1(mg280) pah-1(syb3596) II. Show Description
Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
PHX3678 C elegans tph-1(mg280) pah-1(syb3678[GFP::H2B::T2A::pah-1]) II. Show Description
GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
PHX6451 C. elegans tph-1(syb6451[tph-1::SL2::GFP::H2B]) II. Show Description
Endogenous tph-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
PS8660 C. elegans syIs690; syIs300 Show Description
syIs690 [tph-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR +pdf-1p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. [NOTE: Pick animals with RFP+ coelomocytes to maintain. Array appears to be lost or silenced in some animals.] Split cGAL driver for NSM neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9961 C. elegans imph-1(sy1993) III. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of imph-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAACTACAGGCCGTTCAACAGCAACAAGCCCAAC. Right flanking sequence: AGATGCACCATCGTCTTCAAGGAGCTCCGATCAATC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGACGATGGTGCATCTGTT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
RB1223 C. elegans sph-1(ok1199) IV/nT1 [qIs51] (IV;V). Show Description
F42G8.10 Heterozygotes are WT and GFP+. Outer Left Sequence: aaagtgaacagcaggccaac. Outer Right Sequence: attgtccatcccatcgaaga. Inner Left Sequence: aggaaaccatggctttaggc. Inner Right Sequence: gcttgtgctttcgactttcc. Inner Primer PCR Length: 2101. Estimated Deletion Size: about 1350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
SJZ42 C. elegans foxEx3. Show Description
foxEx3 [rgef-1p::tomm-20::Rosella]. Pick animals with red fluorescence in neurons to maintain. foxEx3 expresses neuron-specific, mitochondrial localized Rosella, a pH-sensitive fluorescent biosensor for monitoring and analyzing mitophagy. Reference: Cummins N, EMBO J. 2019 Feb 1;38(3):e99360. PMID: 30538104
SK4013 C. elegans zdIs13 IV. Show Description
zdIs13 [tph-1p::GFP] IV. Transcriptional tph-1 reporter. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Clark SG & Chiu C. Development. 2003 Aug;130(16):3781-94.
SP2275 C. elegans tsp-15(sv15) I. Show Description
Hypomorph. Dpy. Hypodermal protrusions.
ST3090 C. elegans ncEx3090. Show Description
ncEx3090 [tph-1p::Arch::eGFP + (pCFJ90) myo-2p::mCherry]. Pick GFP+mCherry+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.
STR318 C. elegans unc-119(ed3) III; hrtSi28 IV. Show Description
hrtSi28 [des-2p::mKate2::maph-1.1 + unc-119(+)] IV. hrtSi28 inserted into cxTi10882. Expression of mKate2::MAPH-1.1 microtubule marker in PVD and FLP. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.
SV1009 C. elegans heIs63 V. Show Description
heIs63 [wrt-2p::GFP::PH + wrt-2p::GFP::H2B + lin-48p::mCherry] V. GFP expression in seam cells and mCherry expression in pharynx. Reference: Wildwater M, et al. Development. 2011 Oct;138(20):4375-85.
SV2061 C. elegans he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II; e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Show Description
he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II. e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Superficially wild-type. CRISPR/Cas9 was used to create insertion alleles he314 and he259 insertions into N2 background at sites of known MosSCI insertions ttTi5605 and cxTi10816, respectively. ePDZ–LOV system transgenes allow use of blue light to control protein heterodimerization, in this case, membrane recruitment of ePDZ-tagged proteins of interest. Germline-optimized cytosolic ePDZ::mCherry-tagged SMU-1 (GLO-ePDZ::mCherry::SMU-1), and membrane-bound LOV2 domain fused to a pleckstrin-homology domain (PH::eGFP::LOV). GLO-ePDZ::mCherry is a germline-optimized variant coded to be less prone to silencing in the germline. Reference: Fielmich LE, et al. eLife 2018 Aug 15;7:e38198. doi: 10.7554/eLife.38198.
SWF117 C elegans flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF142 C elegans mod-1(ok103) V; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF150 C elegans ser-5(tm2647) I; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF154 C elegans ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF155 C elegans ser-7(tm1325) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF193 C. elegans ser-4(flv7) III; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF302 C elegans ser-5(tm2647) I; ser-4(flv7) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF380 C elegans ser-5(tm2647) I; ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF415 C elegans lite-1(ce314) gur-3(ok2245) X; flvIs17; flvIs18. Show Description
flvIs17 [tag-168::NLS::GCaMP7F + gcy-28.d::NLS::tagRFPt + ceh-36::NLS::tagRFPt + inx-1::tagRFPt + mod-1::tagRFPt + tph-1(short)::NLS::tagRFPt + gcy-5::NLS-;:tagRFPt + gcy-7::NLS::tagRFPt]. flvIs18 [tag-168::NLS::mNeptune2.5]. This strain can be used for calcium imaging at whole-brain level. Back-crossed 5x to MT21793 after transgene integration. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF420 C elegans ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.