More Fields
Strain Species Genotype
OD2906 C. elegans mdf-1(lt39[mNG::tev::loxP::3xFlag::mdf-1]) V. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous mdf-1 locus using CRISPR/Cas9 engineering. gRNA sequence: tgattgcattaaacatatt Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
OD3913 C. elegans cyb-1(lt125[cyb-1::LAP::mNG::loxP::3xFlag]) IV. Show Description
mNeonGreen and Flag tags inserted at 3' end of endogenous cyb-1 locus using CRISPR/Cas9 engineering. gRNA sequence: atgcgtccacttttgcattc Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD4087 C. elegans cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD5096 C. elegans ify-1(lt212[mNG::ify-1]) II. Show Description
mNeonGreen tag inserted at 5' end of endogenous ify-1 locus using CRISPR/Cas9 engineering. gRNA sequence: catactcgcacaagtcaaaA
OD5149 C. elegans ltSi1668 I; unc-119(ed3) III. Show Description
ltSi1668 [cyb-3p::mNeonGreen::cyb-3(re-encoded)::cyb-3 3'UTR + Cbr-unc-119(+)] I. CYB-3::mNG reporter using its own promoter and UTR; cyb-3 was re-encoded to confer resistance to dsRNA targeting endogenous cyb-3.
OH13988 C. elegans ieSi57 II; unc-3(ot837[unc-3::mNeonGreen::AID]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. The endogenous unc-3 locus is tagged with mNeonGreen and AID degron. mNeonGreen expression is seen in the cholinergic motor neurons, command interneurons, and ASI. Reference: Patel T & Hobert O. eLife 2017.
OH14070 C. elegans bnc-1(ot845[bnc-1::mNeonGreen::AID]) V. Show Description
bnc-1 was modified by CRISPR/Cas9 to create both a GFP-tagged reporter and conditional allele using the auxin-inducible degron (AID). Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14125 C. elegans daf-16(ot853[daf-16::linker::mNeonGreen::3xFlag::AID]) I. Show Description
mNeonGreen tag inserted into endogenous daf-16 locus; AID at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580
OH14486 C. elegans gcy-5(ot835[gcy-5::SL2::mNeonGreen]) II; otTi6 X. Show Description
ot835 [gcy-5::SL2::mNeonGreen] III. otTi6 [hsp16-41p::che-1::2xFLAG] X. otTi6 is a miniMOS insertion of heatshock inducible che-1. Under normal growth conditions, very dim expression of gcy-5 is observed in the ASER and RIGL/R neurons. Upon heatshock, induction of CHE-1 leads to ectopic expression of gcy-5 (ectopic expression varies depending upon age at heatshock and genetic background).
OH14654 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; daf-2(e1370) III. Show Description
Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva et al., submitted
OH14897 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; ieSi60 II; daf-2(e1370) III. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR] II. Temperature sensitive dauer constitutive. Maintain at 15C. Pharyngeal muscle-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
OH14945 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; ieSi61 II; daf-2(e1370) III. Show Description
ieSi61[ges-1p::TIR1::mRuby + unc-119(+)] II. Temperature sensitive dauer constitutive. Maintain at 15C. Intestine-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
OH15227 C. elegans unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID]) III. Show Description
unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press).
OH15439 C. elegans ceh-34(ot903[ceh-34::mNG::3xFLAG::AID]) V. Show Description
CRISPR/Cas9-engineered insertion of mNeonGreen::3xFLAG::AID tags into endogenous ceh-34 locus. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH18012 C. elegans pha-1(e2123) III; otEx7948. Show Description
otEx7948 [lgc-8p::mNeonGreen::PH::p10 + pha-1(+)]. I1 neurons are labeled with mNeonGreen. Can be used to isolate I1 neurons by FACS (green-only). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
PHX1805 C. elegans ser-1(syb1805[ser-1::T2A::mNeonGreen]) X. Show Description
Endogenous ser-1 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Derived in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
PHX1841 C elegans mod-1(syb1841[mod-1::T2A::mNeonGreen]) V. Show Description
Endogenous mod-1 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
PHX1866 C. elegans ser-4(syb1866[ser-4::T2A::mNeonGreen]) III. Show Description
Endogenous ser-4 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
PHX1867 C elegans ser-5(syb1867[ser-5::T2A::mNeonGreen]) I. Show Description
Endogenous ser-5 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
PHX1941 C elegans ser-7(syb1941[ser-7::T2A::mNeonGreen]) X. Show Description
Endogenous ser-7 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
PHX2307 C. elegans ceh-13(syb2307[ceh-13::mNG::AID]) III. Show Description
mNeonGreen and AID tags inserted into endogenous ceh-13 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.
PHX2361 C.elegans egl-5(syb2361[egl-5::mNG::AID]) III. Show Description
mNeonGreen and AID tags inserted into endogenous egl-5 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.
PHX3293 C. elegans bli-2(syb3293[bli-2::mNG]) II. Show Description
mNeonGreen tag inserted at C-terminus of endogenous bli-2 locus. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
PHX3685 C. elegans dpy-17(syb3685[dpy-17::mNG]) III. Show Description
mNeonGreen tag inserted at C-terminus of endogenous dpy-17 locus. GGATACAGAAACTAA -> GGATACAGAAAC^TAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
PHX3691 C. elegans sqt-3(syb3691[sqt-3::mNG(int)]) V. Show Description
mNeonGreen tag inserted into endogenous sqt-3 locus between CFCS and collagen domains. GCCTACGGAGGACCAGAAGTCAACC -> GCCTACGGAGGA^CCAGAAGTCAACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
PHX4698 C. elegans cat-2(syb4698[cat-2::T2A::NeonGreen]) II. Show Description
NeonGreen tag inserted into endogenous cat-2 locus. NeonGreen expression in dopaminergic neurons. Superficially wild type. Reference: Jimeno-Martín A, et al. Genome Res. 2022 Mar;32(3):459-473. PMID: 35074859.
PHX6730 C.elegans mab-5(syb6730[mab-5::3xFLAG::mNG::AID)]) III. Show Description
3xFLAG, mNeonGreen, and AID tags inserted into endogenous mab-5 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.
PT3406 C elegans nekl-4(my51[nekl-4::mNeonGreen]) III; him-5(e1490) V. Show Description
mNeonGreen tag inserted into endogenous nekl-4 locus by CRISPR/Cas9 engineering. Very faint mNeonGreen expression in the dendrites, soma, and axons of all ciliated neurons. Reference: Power KM, et al. PLoS Genet. 2020 Oct 16;16(10):e1009052. PMID: 33064774
RP3498 C elegans trEx1001. Show Description
trEx1001 [idpb-3p::idpb-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.
RP3513 C elegans trEx1006. Show Description
trEx1006 [fipr-4p::fipr-4::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.
RP3515 C elegans trEx1008. Show Description
trEx1008 [idpa-3p::idpa-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.
SBW115 C. elegans lem-2(sbw5[lem-2::mNeonGreen]) II. Show Description
mNeonGreen tag inserted at C-terminus of endogenous lem-2 locus using self-exising drug selection casette method (described by Hastie et al., 2019 J Microbiol Biol Educ). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https://doi.org/10.1242/jcs.261385. PMID: 37795681.
SBW136 C. elegans baf-1(sbw7[mNeonGreen::baf-1]) III. Show Description
mNeonGreen tag inserted at N-terminus of endogenous baf-1 locus using self-excising drug selection cassette method (described by Dickinson, et al. 2015, Genetics). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https://doi.org/10.1242/jcs.261385. PMID: 37795681.
SBW308 C. elegans emr-1(sbw16[mNeonGreen::emr-1]) I. Show Description
mNeonGreen tag inserted at N-terminus of endogenous emr-1 locus using self-excising drug selection cassette method (described by Dickinson, et al. 2015, Genetics). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https://doi.org/10.1242/jcs.261385. PMID: 37795681.
SU875 C. elegans mig-10(jc53[mig-10::mNeonGreen::3xFlag + LoxP]) III. Show Description
Endogenously tagged mig-10. No growth, behavior, or morphological defects observed. Reference: Serre JM & Hardin J. (2022) The Lamellipodin homologue MIG-10 is not essential for dorsal intercalation in the embryonic epidermis of the C. elegans embryo. microPublication Biology. 10.17912/micropub.biology.000522.
SU955 C. elegans tes-1(jc71[mNG::tes-1 + LoxP]) IV. Show Description
mNeonGreen and FLAG tags inserted into endogenous tes-1 locus by CRISPR/Cas9 genome editing. Reference: Lynch AM, et al. Curr Biol. 2022 Dec 5;32(23):5189-5199.e6. doi: 10.1016/j.cub.2022.10.045. PMID: 36384139.
SWF409 C. elegans lgc-50(syb3560[lgc-50::T2A::mNeonGreen]) III. Show Description
Endogenous lgc-50 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SYS1050 C. elegans ujIs113 II; lin-22(dev259([mNeonGreen::lin-22]) IV. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of lin-22 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
SYS148 C. elegans ujIs113 II; unc-3(ot837([unc-3::mNeonGreen::AID]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of unc-3 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
SYS149 C. elegans ujIs113 II; bnc-1(ot845([bnc-1::mNeonGreen::AID]) V. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of bnc-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
SYS397 C. elegans ujIs113 II; ceh-51(dev72([mNeonGreen::ceh-51]) V. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-51 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
SYS398 C. elegans ujIs113 II; lin-32(dev70([mNeonGreen::lin-32]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of lin-32 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
SYS400 C. elegans ujIs113 II; tbx-37(dev91([mNeonGreen::tbx-37]) III. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of tbx-37 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
SYS412 C. elegans ujIs113 II; elt-2(dev99([mNeonGreen::elt-2]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of elt-2 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
SYS422 C. elegans tbx-38(dev93([mNeonGreen::tbx-38]) III; ltIs37 IV; stIs10226. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10226 [his-72p::HIS-24::mCherry::let-858 3' UTR + unc-119(+)]. mNeonGreen knockin at N-terminus of tbx-38 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
SYS423 C. elegans ujIs113 II; F19F10.9(dev94([mNeonGreen::F19F10.9]) V. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of F19F10.9 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
SYS424 C. elegans ceh-5(dev103([mNeonGreen::ceh-5]) I; ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-5 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
SYS427 C. elegans ujIs113 II; ceh-10(dev101([mNeonGreen::ceh-10]) III. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-10 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
SYS429 C. elegans dmd-5(dev104([mNeonGreen::dmd-5]) ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of dmd-5 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
SYS432 C. elegans ujIs113 II; ceh-20(dev106([mNeonGreen::ceh-20]) III. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-20 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.