| NFB1720 |
C. elegans |
tph-1(vlc46[tph-1::T2A::mNeonGreen]) II. Show Description
mNeonGreen tag inserted into endogenous tph-1 locus. Upstream flanking sequence: CTCTCCGCTCAGACATCAACCTGCTCGCCGGAGCTCTCCACTACATCCTG. Downstream flanking sequence: TAGTTTGAGTTTCCGTGTTTTTTATTTTTTTTATTTGGTTTCTGCTTTCT. Guide sequence: GTAGTTTGAGTTTCCGTGTT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB1722 |
C. elegans |
lag-1(vlc30[lag-1::T2A::mNG]) IV. Show Description
mNeonGreen tag inserted into endogenous lag-1 locus. Upstream flanking sequence: CCTACAAATCATTGGAACGACATGGACCGTGCAGAATTGTGTCCAATTAC. Downstream flanking sequence: TAGATTGGTCTCTCGCGGGATTACTGTATCTTTATATTGTCTCCTAATTT. Guide sequence: ATTACTAGATTCCACTCTCG. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB2518 |
C. elegans |
dat-1(syb4741[dat-1::T2A::NeonGreen]) III; him-8(e1489) IV. Show Description
NeonGreen tag inserted into endogenous dat-1 locus by CRISPR/Cas9 engineering. NeonGreen expression in dopaminergic neurons. Superficially wild type. Reference: Jimeno-MartÃn A, et al. Genome Res. 2022 Mar;32(3):459-473. PMID: 35074859.
|
|
| NK2115 |
C. elegans |
cpIs121 I; rrf-3(pk1426) II; rde-1(ne219) V. Show Description
cpIs121 [lag-2p::mNG::PH::F2A::rde-1] I. Temperature-sensitive: maintain at 16-20C. RNAi-response variant. RNAi-hypersensitized DTC-specific RNAi strain that labels all rde-1(+) cells with mNeonGreen. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284.
|
|
| NK2322 |
C. elegans |
cle-1(qy22[cle-1::mNG+loxP]) I. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2326 |
C. elegans |
emb-9(qy24[emb-9::mNG+loxP]) III. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2335 |
C. elegans |
lam-2(qy20[lam-2::mNG+LoxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
|
|
| NK2353 |
C. elegans |
agr-1 (qy27[agr-1::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2404 |
C. elegans |
epi-1(qy31[epi-1::mNG+loxP]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2413 |
C. elegans |
sdn-1(qy29[sdn-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2422 |
C. elegans |
him-4(qy33[him-4::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2425 |
C. elegans |
lam-3(qy28[lam-3::mNG+loxP]) I. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2442 |
C. elegans |
mig-6(qy37[mNG+loxP::mig-6]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. mNeonGreen is inserted at the N-terminus right before a putative proprotein convertase cleavage site and Western analysis indicates most of the mNeonGreen is cut from the MIG-1 protein and is diffuse in the extracellular fluid. See Figure S1 in Keeley et al., Dev Cell. 2020 Jul 6;54(1):60-74.e7. doi: 10.1016/j.devcel.2020.05.022. PMID: 32585132
|
|
| NK2443 |
C. elegans |
nid-1(qy38[nid-1::mNG+loxP]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2444 |
C. elegans |
pxn-2(qy39[pxn-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2445 |
C. elegans |
pxn-1(qy40[pxn-1::mNG+loxP]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2456 |
C. elegans |
ddr-1(qy43[ddr-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2457 |
C. elegans |
ddr-2(qy44[ddr-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2477 |
C. elegans |
ptp-3(qy47[ptp-3::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2478 |
C. elegans |
deb-1(qy48[deb-1::mNG + LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen tag into endogenous deb-1 locus. Low penetrance Rup and Pvl. Reference: Park K, et al. eLife. 2023 Jul 5;12:RP87037. doi: 10.7554/eLife.87037. PMID: 37405383.
|
|
| NK2500 |
C. elegans |
unc-52(qy53[unc-52::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2502 |
C. elegans |
ten-1(qy56[ten-1::mNG+loxP]) III. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2555 |
C. elegans |
unc-52(qy75[mNG+loxP::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2557 |
C. elegans |
mig-6(qy73[mig-6::mNG+loxP]) V. Show Description
Superficially wild-type. Specifically tags the long isoform of mig-6. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2565 |
C. elegans |
pxn-2(qy76[mNG+loxP::pxn-2]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2579 |
C. elegans |
fbl-1(qy62[mNG+loxP::fbl-1]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2580 |
C. elegans |
spon-1(qy30[spon-1::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2581 |
C. elegans |
gpn-1(qy35[gpn-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2582 |
C. elegans |
lon-2(qy55[lon-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2583 |
C. elegans |
unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2590 |
C. elegans |
gon-1(qy45[gon-1::mNG+loxP]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2604 |
C. elegans |
emb-9 (qy89[emb-9::mEos2+loxP]) III. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
| NK2643 |
C. elegans |
lin-35(n745) I; unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous unc-52 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2644 |
C. elegans |
lin-35(n745) I; fbl-1(qy62[mNG+loxP::fbl-1]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous fbl-1 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2645 |
C. elegans |
lin-35(n745) I; him-4(qy33[him-4::mNG+loxP]) X. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous him-4 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2920 |
C. elegans |
emb-9(qy83[emb-9::mRuby2 + LoxP]) III; gon-1(qy45[gon-1::mNG+LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus and mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2922 |
C. elegans |
lin-35(n745) I; gon-1(qy45[gon-1::mNG+loxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2987 |
C. elegans |
let-60(qy220[mNG::let-60 + LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen tag into endogenous let-60 locus. Fairly high penetrance of L1 rod-like lethality. Reference: Jayadev et al. 2023. Post-embryonic endogenous expression and localization of LET-60/Ras in C. elegans. microPublication Biology. 10.17912/micropub.biology.000931.
|
|
| NM5161 |
C. elegans |
jsTi1453 I; bqSi711 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. jsTi1453 is an RMCE landing site inserted using miniMos on Chr I at 11,933,068 ( at 13.1 m.u.) between R06C1.4 and R06C1.6. Insertion site ccctactatcaacgcaaaaactatttggcttttactTAaacataacgttttgaatttgaaaatcaaaaag with rpl-28p trancription toward R06C1.4. bqSi711 expresses nNeonGreen in germline and early embryo. Reference: Nonet ML. Genetics. 2020.
|
|
| NM5176 |
C. elegans |
jsTi1490 IV. Show Description
jsTi1490 [LoxP::mex-5p::FLP::SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsTi1490 is an RMCE landing site inserted using miniMos located on Chr IV at 7,310,985 (at 3.32 m.u.) between glr-4 and F42C5.8. Insertion site gtacataaattataccaaatattgaTAaaagctacgaaaattccactgatat with rpl-28 transcription towards F42C5.8. Reference: Nonet ML. Genetics. 2020.
|
|
| NM5178 |
C. elegans |
jsTi1492 II. Show Description
jsTi1492 [LoxP::mex-5p::FLP::SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] II. jsTi1492 is prone to silencing; pick animals with GFP+ germlines to maintain. jsTi1492 is an RMCE landing site inserted using miniMos located on Chr II at at 3,160,571 (WB273 genome; -8.14 m.u.) inserted in a repeat region between sri-34 and fbxc-55. Insertsion site ttttttgcaaaaaagtgcagtcataTAtgtatgtaaaaaattaattgaagac with rpl-28 transcription toward sri-34. Insertion site is ambiguous but likely near the edge of sri-34 side of the repeat region. Reference: Nonet ML. Genetics. 2020.
|
|
| NM5179 |
C. elegans |
jsTi1493 IV. Show Description
jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsTi1493 is an RMCE landing site inserted using miniMos located on Chr IV at 9,197,338 (at 4.11 m.u.) inserted between C46C2.7 and wnk-1. Insertion site gttcgcaaaccgtctgcgtctctTAttctcttgcaattccgcgcacacac with rpl-28 transcription toward C46C2.7. Reference: Nonet ML. Genetics. 2020.
|
|
| NM5233 |
C. elegans |
jsTi1453 jsSi1518 I; jsTi1493 jsSi1515 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1518 [LoxP::UAS 11X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1515 [LoxP::mec-4p::GAL4-QF::FRT3] IV. RMCE derived single copy UAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p GAL-4-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
|
|
| NM5274 |
C. elegans |
jsTi1453 jsSi1527 I; jsTi1493 jsSi1549 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1527 [LoxP::lexO 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1549 [LoxP::mec-4p::lexA-L-QF::FRT-3] IV. RMCE derived single copy lexO GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p lexA-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
|
|
| NM5275 |
C. elegans |
jsTi1453 jsSi1517 I; jsTi1493 jsSi1551 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1551 [LoxP::mec-4p::QF::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
|
|
| NM5276 |
C. elegans |
jsTi1453 jsSi1543 I; jsTi1493 jsSi1548 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1543 [LoxP::tetO 7X::(delta)mec-7p::(delta)mec-7p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1548 [LoxP::mec-4p::rtetR-L-QF::FRT3] IV. RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet ON mec-4p rtetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
|
|
| NM5312 |
C. elegans |
jsTi1453 jsSi1517 I; jsTi1493 jsSi1554 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1554 [LoxP::mec-4p::QF2::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF2 driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
|
|
| NM5317 |
C. elegans |
jsTi1453 jsSi1519 I; jsTi1493 jsSi1560 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1519 [LoxP::tetO 7X:: (delta)pes10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSI1560 [LoxP::mec-4p::tetR-L-QF::FRT3] IV.RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet OFF mec-4p tetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
|
|
| NM5738 |
C. elegans |
jsSi1815 V. Show Description
jsSi1815 [loxP::mex-5p::FLP::sl2::mNeonGreen + rpl-28p::FRT::GFP::his-58 3' FRT3] V. Single component RMCE landing site on Chromosome V adjacent to oxTi365. Created using CRISPR/cas9 with SEC selection and heat shock excision. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
|
|
| OD2653 |
C. elegans |
ltSi1112 I; unc-119(ed3) III. Show Description
ltSi1112 [cyb-1p::cyb-1::mNeongreen::cyb-1 3'UTR + Cbr-unc-119(+)] I. CYB-1::mNG reporter using its own promoter and UTR. Single-copy transgene insertion in Chromosome I using MosSCI. Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
|
|