More Fields
Strain Species Genotype
RG3373 C. elegans F14H3.12(ve873[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:ATGAACTCCATTCAAATACAAGCGTGGTAG ; Right flanking sequence:CCTGATCAGCAGTCTCCAGCGCAAACCCAA. F14H3.12 sgRNA #1:TGTGCAGACCTGAAAGAACT ; F14H3.12 sgRNA #2:AAGATCAGGCGCGAGCAGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3374 C. elegans F54D5.9(ve874[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1905 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTCCAGCTGCTCCTCTTCTTCTAGTGGAT ; Right flanking sequence: CGGTGGCTCGGTTCGCCGAAACATTTTTAT. F54D5.9 sgRNA #1: CATTGACGAGTTCAGCAGCT; F54D5.9 sgRNA #2: TTTCTAGCCAACAATCGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3375 C. elegans ZK1320.7(ve875[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 520 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATGCAAGCTTCTTCTCGAGCACGGAGCCG ; Right flanking sequence: AGGTGCCAACTACGAAGAAGGACATAATTA. ZK1320.7 sgRNA A: TGAGTCTCGGACACCCGGAT; ZK1320.7 sgRNA B: TAAAAACCTGAAAGTTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3376 C. elegans hum-2(ve876[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 12,034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACCAGCATTGAAGCACGTGTGTTGGCGAGC ; Right flanking sequence: TGGTGATGATATTGTTGTGAAGCAGGTAAT. hum-2 sgRNA A: AATCCGATTATGGAGTCGAT; hum-2 sgRNA B: ACAAAACTGACGACTTACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3377 C. elegans F36D4.5(ve877[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCTTCGACTCACCATTCAGCGATCGAACC; Right flanking sequence: CCCATCACATCCATTGTGCTAGTGGGCGAG. F36D4.5 sgRNA A: AGAAGCAACTGAGAAACTAG F36D4.5 sgRNA B: AACAGCCAGAAGAAAAACTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3378 C. elegans T08A11.1(ve878[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III:-3.39. Show Description
Homozygous viable. Deletion of 3532 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACCCGATTCTGATTATTCCACGAAGAACCT ; Right flanking sequence: CGGCCTCATCATAAACTCTCGAATTTCGAT. T08A11.1 sgRNA #1: CCTGCATTGGGTACCAACGG; T08A11.1 sgRNA #2: GGCGAGCACTGCCTGACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3379 C. elegans ugt-47(ve879[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1932 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCTTCAGTCAGCAATTCATGAACTCCT ; Right flanking sequence: CAATCCTACCATTTGATATTAAATGTGATT. ugt-47 sgRNA #1: GAGTGGGTTATTCAGAATGG; ugt-47 sgRNA #2: CTGATGAATTGGCAAAAGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3380 C. elegans C11E4.6(ve880[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 5859 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATAAAGTTGCGTTGTTTCTCAGCTCGAAA ; Right flanking sequence: CGGCATAACAGTCAGCAAACTACTGAGAAC. sgRNA#1: AAGGGCAAAAAGATTCGAAG ; sgRNA #2:AAGGAACAATGGTACGATGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3381 C. elegans Y38C1AA.6(ve881[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 851 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTGAACAATGTTTCGATCAAAAACATTCCC ; Right flanking sequence: CGGTGTTGGAGTGTTTCAATGAAGATGATG. Y38C1AA.6 sgRNA #1: GTTGCAAATTGGGCATGAAG; Y38C1AA.6 sgRNA #2: AGATTTCCAACTTATTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3382 C. elegans F15A4.10(ve882[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAAATACATTTTTTGGCAGAAAGAAAATG ; Right flanking sequence: TGGAAATGGAGGGGTTTGGCTGAAAATTGA. F15A4.10 sgRNA A: AAATTGATATGGATTTGTGG; F15A4.10 sgRNA B: GGACATTTTGCAAGTTTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3383 C. elegans slc-17.1(ve883[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 3946 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGATATGTTGACCATCTATTCCAGCTGTCC ; Right flanking sequence: TTCGAGAGCCAGTTAGAACTCAAAATGAGT. slc-17.1 sgRNA A: GACAAAGGAAGTGTGCTCTG; slc-17.2 sgRNA B: ACGTTGTGCGAAAAAGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3384 C. elegans plc-3 & srh-135(ve884[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Ste. Deletion of 6,190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve884 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny.  Left flanking Sequence: CTCACTTGGCCCATCATCGTCGTCTCGAAA; Right flanking sequence: TTTTGGAGCATTTTTTATAGTTTAAGTTTA. plc-3_srh-135 sgRNA A: GACTACAGTAACCAGCACAG; plc-3_srh-135 sgRNA B: TTTTGTGGCAAAAAACAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3385 C. elegans plag-15(ve885[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous Mel. Deletion of 1641 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 adults that give dead eggs (ve885 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: GGAAAAAGTGACACGAAATGGTTTGGAAAG; Right flanking sequence: CGGAAAAGTTTTCATGGGCTCCCGGATACT. plag-15 sgRNA A: CCTCCATCATCATACCCGAC; plag-15 sgRNA B: AGTATTTCAAGCTGATCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3386 C. elegans D2092.10(ve886[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 803 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTATTTATCTGTGGCATTAGCTTTCACCA ; Right flanking sequence: CGGTAATGAGATATCCATTCTGTAAGTTGA. D2092.10 sgRNA A: ATTGAAAGAACTCGCTGAGT; D2092.10 sgRNA B: CTTATACTTCTCTCATTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3387 C. elegans M110.3&M110.13(ve887[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1791 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGCAAATAAGAGGAGGAGCGACACTTGAG ; Right flanking sequence: AGGAGAGTTGTGTCGATTTACGCGAGTTGG. M110.3_M110.13 sgRNA A: CACTTCAGCAACCCGTATGG; M110.3_M110.13 sgRNA B: GAGAAATAGCGTGCAAAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3388 C. elegans K10B3.1(ve888[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1215 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCGATCTCGCATTTACTTTTCTGTCTTCCC ; Right flanking sequence: CGGTAAATCCTATTGTTTCATTGTTTCAAA. K10B3.1 sgRNA A: AAGAACAGAACATTGAGAGG; K10B3.1 sgRNA B: CATTTATCACTGATAGATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3389 C. elegans C49F5.5(ve889[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 881 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAACAGCTGATTTTGTTGCTTCATGCAAA ; Right flanking sequence: TGGCGTGAGTGCCAAAATCGTGCTTGTGCA. C49F5.5 sgRNA A: TGTGTGCACCAAAAGAGACA; C49F5.5 sgRNA B: GTGTTTGATGAGTTGCTTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3390 C. elegans +/nT1 [umnIs49] IV; mpdu-1(ve890[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 658 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate adults that give dead eggs (ve890 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TAAGGTTCCGGCGAATTGAAGGAAAACGGA; Right flanking sequence: GGGAAGAGGCTTTGAATGATGTCGTTCATG. mpdu-1 sgRNA A: GATCAGGGAAAGCTGACCGG; mpdu-1 sgRNA B: GTTCTTCGAAACAATTGCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3391 C. elegans Y51H7BR.7(ve891[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAATTTTTCACCAATTGCTGCACGGGCACC ; Right flanking sequence: GCCTGAGACATTTTGTGTccaaaaaaagac. Y51H7BR.7 sgRNA A: AGCTCAGGAAGTCCGCCCGG; Y51H7BR.7 sgRNA B: TAGTTCCGCCAAACACGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3392 C. elegans K09F6.11 & K09F6.14(ve892[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 451 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAAAACTGATTCATTCAGTGTTCTTAACCT ; Right flanking sequence: CGGACGCTGACGACTCTGACGACGATAACG. K09F6.11 sgRNA A: TGTTAGAACCTTTCAGGACA; K09F6.11 sgRNA B: AGCCCAGAAAGACTGTCTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3393 C. elegans marc-3(ve893[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1895 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCAAGAGTCTCCACATGGAAACGACCT ; Right flanking sequence: CGCTGGACCCAGCGATGCGTTGAAGTCTTC. marc-3 sgRNA #1: GTAACTATTGATTCGCAACG; marc-3 sgRNA #2: GTGTGTCGGATATGTATGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3394 C. elegans lsd-1(ve894[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 2241 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGCTGATAGACCAACGGAAATTGAAGCCG ; Right flanking sequence: GCACACTAGCGCATTGGAACATGGAACATT. lsd-1 sgRNA #2: TCACCAGCAAAAAATACCCG; lsd-1 sgRNA #3: TTGGACTTCTGGGAAAAACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3395 C. elegans +/nT1 [umnIs49] IV; rpb-9(ve895[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Apparently semi-sterile. Deletion of 753 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate apparently semi-sterile adults (ve895 homozygotes) can be maintained as a homozygote with difficulty, Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGGAGCGTTGGATCGTGAATAATATCTCCG; Right flanking sequence: TGGCTCATCTTTCTGAAAAAATATGATAAA. rpb-9 sgRNA A: AGTGAGCTCACTCAAATCGT; rpb-9 sgRNA B: CATCGTAATTATCATACCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3396 C. elegans Y67A6A.1(ve896[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 583 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTATTAAAATACAATACTAAAAGATTCCT ; Right flanking sequence: CTTTTATGCTACGAACGCAGTGAAAAACTC. Y67A6A.1 sgRNA A: GTCGAGAAACTGAAGCAAAA; Y67A6A.1 sgRNA B: CTCTGCTCGAGTCACAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3397 C. elegans F59B2.14(ve897[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1106 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTAAAATGTCCTTAATCATGAAACTTCTT ; Right flanking sequence: GATTCATCATATGTAGCGCAAAGCCATTCA. F59B2.14 sgRNA A: ACTTTCGTCGGTTCTCTGCT; F59B2.14 sgRNA B: AACTACAAGTGGCGAAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3398 C. elegans C45B11.6(ve898[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1273 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCCGATTTTCCACCACTTGAAATTGATCCT ; Right flanking sequence: ATTGGAAGATAGATATTTGAATTTGACAAG. C45B11.6 sgRNA A: TCAAGCTTCCAATAGTCATC; C45B11.6 sgRNA B: ATATCTTTCGAGCATCTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3399 C. elegans Y34D9A.7(ve899[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 6469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAGTAAAAAAATGTCTGAAGATGGAGAAAT ; Right flanking sequence: ATTCATCGGCACCCCGATCTTCTCCCGCCG. Y34D9A.7 sgRNA A: ATCACTTTCACCCAATTCGG; Y34D9A.7 sgRNA B: TCCGAAATTGATTCTCCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3400 C. elegans +/mT1 [umnIs52] II; rps-13(ve900[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 ve900 homozygotes (larval arrest), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TCCAGGTTGGTGGAAGCTGACGCTTGGTCT; Right flanking sequence: ACCCATGGTTGATGCGGATTACCTGAAAGA. rps-13_C16A3.11 sgRNA A: TGTAGTATCTAGCCAAACGG; rps-13_C16A3.11 sgRNA B: CGCATGCACAATCCAGGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3401 C. elegans rps-10(ve901[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Egl, Emb. Deletion of 479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Egl adults that have no viable eggs or hatch a few sickly progeny (ve901 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: CATTTATTGTGGTGGTGGGGCTCCACGGCC; Right flanking sequence: AGGTACTCATAGATGAGCTTGGTGTGGCTT. rps-10 sgRNA A: GAATCCGGCTCTGTAGACTG; rps-10 sgRNA B: CAGTCACTCCCTCGTTGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3402 C. elegans ZK993.5(ve902[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3478 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAGTGATAACGGGTGTGTTGCAATACCA ; Right flanking sequence: TATTTTAATCAGTTATGATAACTTTATGAT. ZK993.5 sgRNA A: CCAAGTAAGAATTATAGTGG; ZK993.5 sgRNA B: TATTAGCATATCCAACAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3403 C. elegans ZK1240.9(ve903[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1214 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttgttcaatttatcgcgtgtgtggcaa ; Right flanking sequence: CGCAGGCATTGGCCAAGTTGAAAACTATCG. ZK1240.9 sgRNA A: atttccaaccttgccgaact; ZK1240.9 sgRNA B: ACGGCTTTATGAAGAAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3404 C. elegans pho-6(ve904[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGCATAAAGCAATGCAGAAAGTGTTCCA ; Right flanking sequence: GCTTGCATTATTATTAAATTCGCAGTTGAA. pho-6 sgRNA A: AATCTTCAATTCCAGCACGA; pho-6 sgRNA B: AATTTGGAGACACGGAGACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3405 C. elegans F56A6.5(ve905[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1286 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCACAAGCACATTTAATTTTTCAAACCCCC ; Right flanking sequence: GCATTCAGTAACCTTCATCGCAAAAATAGT. F56A6.5 sgRNA A: GATTTCTTCATGACTCCTGA; F56A6.5 sgRNA B: AGTATATGCTATGATGAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3406 C. elegans tbx-32(ve906[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1714 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTGAAAAAGGAAAGAGGGGTGTGGTCAAT ; Right flanking sequence: GGATGACAACGCTATCTTTGAGCATTTTTT. tbx-32 sgRNA A: ATGGAGCATTATCAAGAAGG; tbx-32 sgRNA B: TCCACGTTTTCTTCAAGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3407 C. elegans slc-17.5(ve907[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1674 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTCCCCATTCTTCAGCAGTTCCAACAGTC ; Right flanking sequence: GATAGTGATAATCCGATGTGAGCTGTCATT. slc-17.5 sgRNA A: TTGTAATATGAGATCATGAG; slc-17.5 sgRNA B: ATGTATGTGCAACTCAACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3408 C. elegans +/nT1 [umnIs49] IV; C37C3.18(ve908[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 801 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ arrested larvae (ve908 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGAGATCCAGTTGTGCATGTTCTTGTGCCC; Right flanking sequence: TATTTATCATTTGTAAGTACTAACAAGAGA. C37C3.18 sgRNA #1: AAATGGGCGCGAGTTTGTGT; C37C3.18 sgRNA #2: TCACGAGTCCGGTTGATATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3409 C. elegans tsp-20(ve909[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTTGGGGCTATCACTCAAAGCACAGCCCT ; Right flanking sequence: AGGTATGAAATGAACAATTGACATTTTGAA. tsp-20 sgRNA A: CAAGAGTACACATCAACGGA; tsp-20 sgRNA B: AAACTATACTTACCACAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3410 C. elegans phf-34(ve910[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 2012 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTAACTATGAGAAATTATACTAAAATACAG ; Right flanking sequence: ATAGCAATCGAAATCACTATAAACTATTTA. phf-34 sgRNA A: ACAAACGTAGAGTGTAACGA; phf-34 sgRNA B: CGATTTTACACAGTTCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3412 C. elegans B0393.6(ve912[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1655 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATTGGGAGTAATATGAAGAGTTCTGGAAG ; Right flanking sequence: CGGAAAAGTTGCGGAGCGAGCATCATATTC. B0393.6 sgRNA A: GTAAAATGAGGTCAAAATGA; B0393.6 sgRNA B: GGCACGGCCTGACAATATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3413 C. elegans ZC190.4(ve913[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:AAAAAGTTGCGACTCCATAAATATGCTCCT ; Right flanking sequence:TTTCAATTTACAAAAATAGGTTAGCCATGT. ZC190.4 sgRNA #1:TATGTCATGTCTTGGAAGAG ZC190.4 sgRNA #2:GATGGGGTTATTACACAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3414 C. elegans pipp-4P(ve914[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous ste. Deletion of 7788 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve914 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+.  Left flanking Sequence: AAACCCCCTAAAATCTTCAAATTTTTCTGT; Right flanking sequence: TCAGGGTATATGCAAAAGATTCGAGCTCTC. Y71H2AM.2-sgRNA A: AGGAATGGACGTACCACCAG; Y71H2AM.2-sgRNA B: AAATTAGCGGGAAATTTGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3415 C. elegans taf-8(ve915[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 1934 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve915 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: GAATGCTTCCTCAACACAATACATTTATTA ; Right flanking sequence: ACGACTACGGCAATTATGAGGATGAAGAGA. taf-8 sgRNA A: GGAGACCGACTATTGCAGGA; taf-8 sgRNA B: TGTCGCGTATCGGAGGGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3416 C. elegans prx-2(ve916[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Maintain by picking wild-type GFP+ mKate2+. ve916 homozygotes are thin, slow-growing, lay small, slow-growing broods. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 thin slow growing hermaphrodites that can be maintained as a homozygous slow growing population (ve916 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Deletion of 1288 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCTTCCCAATAATACACTACACTGTACCCT; Right flanking sequence: TGGTCATTCTACAATAACTGAAAGCATTTT. prx-2 sgRNA A: AGGAATAGTGATAGTGGGGG; prx-2 sgRNA B: CTCTATTTCCTTCGATCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3417 C. elegans Y38C1AA.19(ve917[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1665 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTCCTAAGTTATTTTCTTATCGGACTCCT ; Right flanking sequence: tttcggctgttttccggctggcagcgAGTT. Y38C1AA.19 sgRNA A: CATTTTATTGACGACTGATA; Y38C1AA.19 sgRNA B: aactatacgttgtcggctgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3418 C. elegans hpo-39(ve918[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 712 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tttctgttataagcgtcagctctcaactct ; Right flanking sequence: AAAGCGAAGAAATCCGTCTTCACCATAGGC. hpo-39 sgRNA A: ctcaggatagataacatcgt; hpo-39 sgRNA B: CCGGGAGATAAGGACCAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3419 C. elegans T27F6.6(ve919[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3262 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAGAAAGTCGACATGGAGCCGGTTTTCCG ; Right flanking sequence: CGGAAGGCTTTGAAGGCCGCAAAACAGGCG. T27F6.6 sgRNA A: ACGCGGCGAATGATTCCCGG; T27F6.6 sgRNA B: TTATTGGCTTAACGTTGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3420 C. elegans Y48G1C.6(ve920[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1281 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATCAGAATCTGATTCGTGGCCGTTTTCCT ; Right flanking sequence: TGGAGACAGCAAATTGGCACACACGCAGAG. Y48G1C.6 sgRNA A: CCGCCAGAACTTTAGGAACT; Y48G1C.6 sgRNA B: GAACGAAGGGGCAAGACTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3421 C. elegans F44E5.4 & F44E5.5(ve921[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 4584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:AATTAATCAACTTCCTCAACAGTAGGTCCT ; Right flanking sequence:AATGTTGTTCTAATAAATTTACAAAAATCT. sgRNA: AATCCTAACAATTATCCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3422 C. elegans clec-86(ve922[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 512 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cttgtcgcgcttttgtgttttgtgtCACCA ; Right flanking sequence: CCCACCATGTCCATCTTGTTCTAAATAACT. clec-86 sgRNA A: GTATCTCCAGGAAGACAATT; clec-86 sgRNA B: CATGTGTACGATCCTCCAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3423 C. elegans F25B4.7(ve923[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1194 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGTTCACCAGGGCTCCATGGAAAAATGCCT ; Right flanking sequence: CATCTCTCGTTTTTATATAATTTTCACTAC. F25B4.7 sgRNA A: TTACACGAAGGAAGGACCCA; F25B4.7 sgRNA B: TCGGTGTACACAGCAGTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.