More Fields
Strain Species Genotype
OH4326 C. elegans pha-1(e2123) otEx239. Show Description
otEx239 [C53B7.1::GFP + pha-1(+)]. Maintain by picking GFP+. At 25C, only animals with the array should be alive.
OH4343 C. elegans otIs133 II; otEx2498. Show Description
otEx2498 [gcy-18(prom1)::GFP + rol-6(su1006)]. Expresses GFP in AFD and AIM. Maintain by picking GFP+ animals (which should also be Rollers). otIs133 [pttx-3::RFP + unc-4(+)]. RFP expressed in AIY only.
OH4460 C. elegans otEx2572. Show Description
otEx2572 [unc-97::NLS::GFP]. GFP expressed strongly in muscle. Maintain by picking GFP+ animals.
OH707 C. elegans cog-1(ot38)/+ II; otIs114 I. Show Description
otIs114 [lim-6::GFP + rol-6(su1006)]. Rollers. Heterozygous strain. Heterozygotes should be fertile and segregate some sterile progeny. Maintain by picking plenty of animals with GFP in both ASEL and ASER; many of them will be sterile (homozygotes). otIs114 is normally expressed only in ASEL and excretory gland cell. Homozygous ot38; otIs114 is sterile and expresses GFP in both ASEL and ASER neurons. Heterozygotes display a semi-dominant, partially penetrant "ASEL + ASER" phenotype.
OH7546 C. elegans vtIs1 V; otIs198. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. otIs198 [hsp16-2::ast-1 + ttx-3::DsRed + hsp16-2::NLS::mCherry]. Rollers. Heat shock induces expression of nuclear mCherry and AST-1. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
OH9545 C. elegans otIs287 IV. Show Description
otIs287 [rab-3(prom1)::2xNLS::YFP + rol-6(su1006)] IV. Rollers. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH9609 C. elegans otIs291 V. Show Description
otIs291 [rab-3(prom1)::2xNLS::YFP + rol-6(su1006)] V. Rollers. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH9838 C. elegans otIs232; otEx4359. Show Description
otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. Rollers. mCherry expression in ASER and ASEL. otEx4359 [die-1(prom8)::2NLS::YFP + elt-2::DsRed]. Pick animals with dsRed+ intestinal nuclei to maintain otEx4359. otEx4359 carries a minimal (1 kb) promoter driving 2NLS::YFP only in ASEL.
OP753 C. elegans unc-119(tm4063) III; wgIs753. Show Description
wgIs753 [bar-1::TY1::EGFP::3xFLAG + hlh-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. Originally was described as carrying only bar-1 reporter, but since found to also carry the hlh-1 reporter. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
PD1594 C. elegans ccTi1594 unc-119(ed3) III. Show Description
ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. GFP expression in germline. Transgene rescues unc-119(ed3). Improved GPR-1 over-expression transgene appears to be stably expressed in the germline at a wide range of temperatures and does not require special handling. (unlike other GPR-1 overexpressing transgenes previously described in the literature). The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance. Neomycin resistant. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.
PD4251 C. elegans ccIs4251 I; dpy-20(e1282) IV. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. This strain produces GFP in all body wall muscles and vulval muscles, with a combination of mitochondrial and nuclear localization. ME0. Heterozygous males mate well. Integrated array (ccIs4251) contains 3 plasmids: pSAK2 (myo-3 promoter driving a nuclear-targeted GFP-LacZ fusion), pSAK4 (myo-3 promoter driving motochondrially targeted GFP), and a dpy-20 subclone. Array rescues dpy-20(e1282ts).
PD6249 C. elegans ccIs4251 I; tam-1(cc567) V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Homozygotes have decreased expression of tandem array transgenes, decreased fertility, and high incidences of males at 25C. Maintain at 15C.
PE254 C. elegans feIs4 V. Show Description
feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
PE255 C. elegans feIs5 X. Show Description
feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
PE327 C. elegans glp-4(bn2) I; feIs5 X. Show Description
feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. Temperature-sensitive sterile. Maintain at 15C. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
PE328 C. elegans glp-4(bn2) I; feIs4 V. Show Description
feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. Temperature-sensitive sterile. Maintain at 15C. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
PE863 C. elegans feIs4 V; aak-2(ok524) X. Show Description
feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
PE870 C. elegans feIs4 V; rmIs133. Show Description
feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. rmIs133 [unc-54p::Q40::YFP]. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
PE871 C. elegans feIs4 V; pkIs2386. Show Description
feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. alphasynuclein::YFP is localized throughout the body-wall muscle cells. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
PE872 C. elegans feIs5 X; pkIs2386 Show Description
feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. alphasynuclein::YFP is localized throughout the body-wall muscle cells. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
PE873 C. elegans feIs5 X; dvIs14. Show Description
feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. dvIs14 [(pCL12) unc-54::beta 1-42 + (pCL26) mtl-2::GFP]. Rollers. mtl-2::GFP produces strong constitutive intestinal expression of GFP at all developmental stages. Expresses human AB peptide and accumulates B-amyloid fibrils. AB toxicity enhanced at higher temperatures. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
PE874 C. elegans feIs5 X; dvIs15. Show Description
feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. dvIs15 [(pPD30.38) unc-54(vector) + (pCL26) mtl-2::GFP]. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
PE97 C. elegans hmp-1(fe4) V. Show Description
Semi-viable Vab. Homozygotes produce approximately 40% arrested embryos/L1 larvae. Severe morphogenesis defects show maternal rescue: homozygous progeny of heterozygotes display only minor morphological defects.
PHX1446 C. elegans nlp-8(syb762) I; nlp-32(syb431) cnc- 6(syb393) III, Y43C5A.3(syb761) IV; sybDf2 sybDf1 cnc-10(syb937) nlp-25(syb579) cnc-7(syb558) V. Show Description
Reduced survival after wounding. PHX1446 carries knockouts of 19 members of the nlp and cnc peptide families. sybDf1 is a deletion of a gene cassette including nlp-34, nlp-31, nlp-30, nlp-29, nlp-28, and nlp-27. sybDf2 is a deletion of a gene cassette including cnc-11, cnc-1, cnc-5, cnc-4, cnc-3, and cnc-2. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
PHX2616 C. elegans ins-9(syb2616[ins-9::T2A::3xNLS::GFP]) X. Show Description
Endogenous ins-9 locus tagged with 3xNLS::GFP reporter.
PHX2685 C. elegans ins-6(syb2685[ins-6::T2A::3xNLS::GFP]) II. Show Description
Endogenous ins-6 locus tagged with 3xNLS::GFP reporter.
PHX2704 C. elegans nlp-50(syb2704[nlp-50::T2A::3xNLS::GFP]) II. Show Description
Endogenous nlp-50 locus tagged with 3xNLS::GFP reporter.
PHX2878 C. elegans ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. Show Description
T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous ric-4 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX3072 C. elegans rab-3(syb3072[rab-3::T2A::3xNLS::GFP]) II. Show Description
T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous rab-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX3195 C elegans flp-33(syb3195[flp-33::T2A::3xNLS::GFP]) I. Show Description
GFP tag inserted into endogenous flp-33 locus using CRISPR/Cas9 engineering. GFP expression in ADE (in head). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
PHX3207 C. elegans flp-28(syb3207[flp-28::T2A::3×NLS::GFP]) X. Show Description
Endogenous flp-28 locus tagged with 3xNLS::GFP reporter.
PHX3252 C. elegans unc-10(syb2898 syb3252[unc-10::T2A::3xNLS::GFP]) X. Show Description
T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous unc-10 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX3323 C. elegans flp-14(syb3323[flp-14::T2A::3xNLS::GFP]) III. Show Description
Endogenous flp-14 locus tagged with 3xNLS::GFP reporter.
PHX3411 C. elegans nlp-13(syb3411[nlp-13::T2A::3xNLS::GFP]) V. Show Description
Endogenous nlp-13 locus tagged with 3xNLS::GFP reporter.
PHX3588 C. elegans flp-26(syb3588[flp-26::T2A::3xNLS::GFP]) X. Show Description
Endogenous flp-26 locus tagged with 3xNLS::GFP reporter.
PHX530 C. elegans nlp-11(syb530) II. Show Description
Superficially wild-type. syb530 is a 2042 bp deletion of the entire nlp-11 gene. Flanking sequences: tatttctcctattgagtgcaaaaaagagtgaaa-acatcaacaaataaaataccataccaacgagt Primers for genotyping: Fwd: gtcctcaccattcccctagg Interal (fwd): TCTGATCGACGCTGGAAAGA Rev: gaataggaagagggcggagg PCR product: WT 264 bp / syb530 -- ; WT 2551 bp / syb530 509 bp. Reference: Konietzka J, et al. Curr Biol. 2020 Jan 6;30(1):1-16.e13. doi: 10.1016/j.cub.2019.10.048. PMID: 31839447
PJ1271 C. elegans daf-4(m592) III; ccIs55 V; daf-3(e1376) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. daf-4 is temperature-sensitive and dauer formation (not body size) phenotype is suppressed by daf-3. Dauers will form only when plates are crowded, starved, and maintained at 26C. Animals are small at 25C.
PJ1277 C. elegans ccIs4251 I; unc-51(e369) ccIs55 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. ccIs55 [unc-54::lacZ + sup-7(st5)] V. GFP expression in nuclei and mitochondria of muscle cells.
PQ535 C. elegans alg-1(ap428 [alg-1::Y45F10D.4 3'UTR]) X. Show Description
alg-1(ap428 [alg-1::Y45F10D.4 3’UTR]) X. alg-1 control strain. ap428 is a CRISPR-engineered allele in which the endogenous alg-1 3'UTR was replaced by the Y45F10D.4 3'UTR. The Y45F10D.4 3'UTR was chosen because it appears to be stably expressed, is commonly used as a control gene in quantitative RT-PCR experiments, and its short 3’UTR lacks ALG-1 binding sites. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.
PS295 C. elegans let-23(sy97) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozgyotes are WT and segregate WT, DpyUncs and Vulvaless Unc-4s. sy97 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS302 C. elegans let-23(sy10) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. sy10 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS6844 C. elegans syIs301 V. Show Description
syIs301 [myo-2p:NLS::GAL4SC::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].  myo-2 cGAL driver for pharyngeal muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6916 C. elegans syIs317 II. Show Description
syIs317 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript].  nlp-40 cGAL driver for intestine.  NOTE: Incorrectly annotated as being on LG III in paper; actually should be on LG II.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6934 C. elegans syIs319 III. Show Description
syIs319 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] III.  nlp-40 cGAL driver for the intestine.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6935 C. elegans syIs320 V. Show Description
syIs320 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] V.  nlp-40 cGAL driver for intestine.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6936 C. elegans syIs321 I. Show Description
syIs321 [myo-3p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript].  myo-3 cGAL driver for body wall muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6961 C. elegans syIs334 X. Show Description
syIs334 [rab-3p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP +  pBlueScript].  rab-3 cGAL driver for the whole nervous system.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS6963 C. elegans syIs336 X. Show Description
syIs336 [rab-3p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP +  pBlueScript].  rab-3 cGAL driver for the whole nervous system.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7154 C. elegans syIs391 IV. Show Description
syIs391 [myo-2p::NLS::GAL4SK::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].  myo-2 cGAL driver for pharyngeal muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7160 C. elegans syIs393 IV. Show Description
syIs393 [unc-47p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP +  pBlueScript].  unc-47 cGAL driver for GABAergic neurons.  Relatively weak expression. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.