Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
NL735 C. elegans unc-2(pk95::Tc1) X. Show Description
NL737 C. elegans mut-2(r459) I; mek-1(pk97) X. Show Description
K08A8.1 Previously called kin-17(pk97).
NL742 C. elegans rskn-1(pk209::Tc1) mut-2(r459) I. Show Description
Dpyish. Primers used to isolate pk209 are: cgatcctcgacagtttgaactgc & cgagattcagggcatgtctatgc.
NL746 C. elegans pax-3(pk233) II. Show Description
NL772 C. elegans clp-2(pk323) III. Show Description
NL787 C. elegans gpa-11(pk349) II. Show Description
NL788 C. elegans gpa-14(pk347) I. Show Description
[NOTE: (07/16/2015) The correct genotype of this strain is gpa-14(pk347) I. not gpa-14(pk342) as previously reported.]
NL790 C. elegans gpa-4(pk381) IV. Show Description
NL791 C. elegans prk-2(pk439) I. Show Description
Homozygous prk-2 deletion allele.
NL792 C. elegans gpc-1(pk298) X. Show Description
Molecular null. No morphological changes. Wild type locomotion and egg laying.
NL793 C. elegans gpa-9(pk438) V. Show Description
NL795 C. elegans gpa-7(pk610) IV. Show Description
NL796 C. elegans cln-3.1(pk479). Show Description
F07B10.1 TAAACAACTT GATCCAATTC. Df.
NL797 C. elegans gpa-15(pk477) I. Show Description
NL917 C. elegans mut-7(pk204) III. Show Description
Mutator strain. Throws males. See WBG 14(2): 24. Strain has a ts phenotype: dies out at 25C, grows at 20C, but best kept at 18-20C. Not known whether it is the mut-7 allele that is ts or something else.
NLS1 C. elegans cdc-7(knu709) I. Show Description
CRISPR-engineered deletion removing entire cdc-7 gene. Out-crossed 3x to N2. Reference: Currey HN & Liachko NF. 2019. A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects. microPublication Biology. Jan 3;2019:10.17912.
NM1448 C. elegans jsIs37 rpm-1(js410) V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js410 has linked phenotype of reduced brood size. js410 is an R->Stop at aa 235. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.
NM1455 C. elegans jsIs37 rpm-1(js317) V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js317 is a W->Stop at aa 861. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.
NM1489 C. elegans dhc-1(js319) I; jsIs37 V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope.May be slightly Unc. dch-1 alias sam-11.
NM2040 C. elegans dhc-1(js121) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); jsIs37 V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Heterozygotes are GFP+ in the pharynx. dhc-1 homozygotes are GFP- and sterile or partially sterile pvuls. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP js121 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
NM5402 C. elegans jsSi1579 II; bqSi711 IV. Show Description
jsSi1579 [loxP::rpl-28p::FRT::GFP::his-58 FRT3] II. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.
NM5471 C. elegans jsSi1669 IV. Show Description
jsSi1669 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3’ rpl-28p::FRT::GFP::his-58::FRT3] IV. Single component RMCE landing site on Chr IV adjacent to the site of the commonly used ttTi10882 MosSCi insertion site.
NM5500 C. elegans jsSi1691 II. Show Description
jsSi1691 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3' rpl-28p::FRT::GFP::his-58::FRT3] II. Single component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.
NM5548 C. elegans jsSi1726 II. Show Description
jsSi1726 [loxP myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] II. Single component rapid RMCE landing site on Chromosome II adjacent to ttTi5605. Created from jsSi1579 (and jsSi1706) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
NM5549 C. elegans jsSi1727 I. Show Description
jsSi1727 [mosL::loxP::myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3::mosR] I. Single component rapid RMCE landing site on Chromosome I at jsTi1453. Created from jsTi1453 (and jsSi1710) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
NM5753 C. elegans jsSi1837 IV. Show Description
jsSi1837 [loxP::mec-4Sp::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] IV. Single component rapid RMCE landing site on Chromosome IV adjacent to cxTi10882. Created from jsSi1669 (and jsIs1824) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
NM5922 C. elegans jsSi1944 II. Show Description
jsSi1944 [loxP::mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5934 C. elegans jsSi1962 I. Show Description
jsSi1962 [mosL::loxP::FRT + myo-2p::nls::CyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5937 C. elegans jsSi1971 I. Show Description
jsSi1971 [mosL::loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5938 C. elegans jsSi1978 V. Show Description
jsSi1978 [loxP::FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5943 C. elegans jsSi1986 IV. Show Description
jsSi1986 [loxP + myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP::D5 glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5944 C. elegans jsSi1987 V. Show Description
jsSi1987 [loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5946 C. elegans jsSi1985 V. Show Description
jsSi1985 [loxP + myo-2p::FRT::nls::CyOFP myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5953 C. elegans jsSi1949 II; him-8(e1489) IV. Show Description
jsSi1949 [loxP + myo-2p::FRT::nls::mNG myo-2 3' + <{rps-0p HygR unc-54 3'} ori <{Amp} <{mex-5p nls-Cre tbb-2 3'} + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5970 C. elegans jsSi1973 I; him-8(e1489) IV. Show Description
jsSi1973 [mosL + loxP + myo-2p::FRT::nls::mNG::myo-2 3' + <{rps-0p::HygR::unc-54 3'} + ori <{Amp} <{mex-5p::nls::Cre::tbb-2 3'} + FRT3 + mosR] I. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5989 C. elegans jsSi1963 IV. Show Description
jsSi1963 [loxP + FRT::myo-2p::nls::CyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM6007 C. elegans jsSi1901 II. Show Description
jsSi1901 [loxP + FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM6024 C. elegans jsSi2029 IV. Show Description
jsSi2029 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + mex-5p::nls::Cre::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM6037 C. elegans jsSi2049 V. Show Description
jsSi2049 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} mex-5p::nls::Cre::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM6168 C. elegans jsSi2027 II; him-8(e1489) IV. Show Description
jsSi2027 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} + mex-5p::nls::Cre::glh-2 3' + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM664 C. elegans jsIs37 IV; lin-15B&lin-15A(n765) X. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope.
NR220 C. elegans kzIs7. Show Description
kzIs7 [lin-26p::NLS::GFP + rol-6(su1006)]. Maintain by picking Rollers.
NR221 C. elegans rde-1(ne219) V; kzIs8. Show Description
kzIs8 [lin-26p::NLS::GFP + rol-6(su1006)]. Maintain by picking Rollers.
NR222 C. elegans rde-1(ne219) V; kzIs9. Show Description
kzIs9 [(pKK1260) lin-26p::NLS::GFP + (pKK1253) lin-26p::rde-1 + rol-6(su1006)]. Rollers. Hypodermis specific RNAi.
NR350 C. elegans rde-1(ne219) V; kzIs20. Show Description
kzIs20 [hlh-1p::rde-1 + sur-5p::NLS::GFP]. Muscle specific RNAi. kzIs20 genotype differs from published data; this information is correct per Hiroshi Qadota.
OD63 C. elegans unc-119(ed3) III; ltIs43/+. Show Description
ltIs43[pAA26; pie-1::GFP-TEV-STag::ZEN-4; unc-119(+)]. Insertion only viable when heterozygous. Pick non-Unc worms to maintain.
OG472 C. elegans drSi2 II; unc-119(ed3) III. Show Description
drSi2 [vha-6p::3XFLAG::pgp-3/CFTR(wt)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with enrichment at the apical membrane. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR (TIKENIIFG). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9.
OG474 C. elegans drSi4 II; unc-119(ed3) III. Show Description
drSi4 [vha-6p::3XFLAG::pgp-3/CFTR(delta F508)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with significantly diminished expression as compared to drSi2. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR with F508 deleted (TIKENII_G). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9.
OG496 C. elegans drSi12 II; unc-119(ed3) III. Show Description
drSi12 [hsf-1p::human hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+) II. Human hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the C. elegans hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules only after prolonged (1 hr) 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG576 C. elegans hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, larval-arrested ok600 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. [NOTE: Although ok600 has been reported as a 1085 bp deletion in hsf-1, sequencing of the hsf-1 PCR product revealed only an 877 bp deletion (5'-AAATAAAAATTTCTTAGAAA [877 bp deletion] TGTACATGGGATCCGGTCCA-3'). (Lamitina Lab, 12/17/2012)]