| NL2511 |
C. elegans |
msh-6(pk2504) I. Show Description
Mutator phenotype. Enhanced level of spontaneous mutations (frameshifts and single base pair substitutions). The genomic region that is deleted in NL2511 is from nt 24180-25956 (takes out exon 5 and part of exon 6).
|
|
| NL2550 |
C. elegans |
ppw-1(pk2505) I. Show Description
ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. Multiple polymorphisms in C18E3.7 including a single base deletion in ppw-1 resulting in an early stop codon.
|
|
| NL2808 |
C. elegans |
pxf-1(pk1331)/dpy-20(e1363) IV. Show Description
Pick WT to maintain. The pk1331 allele can be followed by PCR.
|
|
| NL3161 |
C. elegans |
pkIs1330 I; tpa-1(pk1401) dpy-20(e1282) IV. Show Description
pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.
|
|
| NL3223 |
C. elegans |
nxf-1(pk386) V. Show Description
Suppressor of activated Gs. Temperature sensitive allele.
|
|
| NL3231 |
C. elegans |
acy-1(pk484) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
|
|
| NL3300 |
C. elegans |
rsd-6(pk3300) I. Show Description
Resistant when fed dsRNA. Contains a point mutation at position 7120 (c to t) (W575 STOP).
|
|
| NL3304 |
C. elegans |
rsd-4(pk3304) III. Show Description
Resistant to feeding dsRNA but sensitive to dsRNA injection.
|
|
| NL3307 |
C. elegans |
rsd-2(pk3307). Show Description
Resistant when fed dsRNA. Contains a point mutation at position 13832 (c to t) (R1000 STOP).
|
|
| NL332 |
C. elegans |
gpa-1(pk15) V. Show Description
|
|
| NL3321 |
C. elegans |
sid-1(pk3321) V. Show Description
Resistant to feeding dsRNA but sensitive to dsRNA injection. PKA rsd-8.
|
|
| NL334 |
C. elegans |
gpa-2(pk16) V. Show Description
Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.
|
|
| NL335 |
C. elegans |
gpa-3(pk35) V. Show Description
Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.
|
|
| NL3400 |
C. elegans |
pkIs1604. Show Description
pkIs1604 [hsp-16.2::ATG(A)17GFP::LacZ + rol-6(su1006)]. Rollers.
|
|
| NL3401 |
C. elegans |
pkIs1605. Show Description
pkIs1605 [hsp-16.2p::GFP::LacZ + rol-6(su1006)]. Rollers.
|
|
| NL344 |
C. elegans |
gpb-1(pk44)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT (heterozygotes), L1 arrested animals (pk44 homozygotes), and paralyzed Dpy Uncs (mnC1 homozygotes).
|
|
| NL348 |
C. elegans |
gpa-2(pk16) gpa-3(pk35) V. Show Description
Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.
|
|
| NL3511 |
C. elegans |
ppw-1(pk1425) I. Show Description
ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. The genomic region that is deleted: nt 2479-3982 of C18E3 (intragenic deletion in C18E3.7). This strain was formerly called NL2557.
|
|
| NL3531 |
C. elegans |
rde-2(pk1657) I. Show Description
Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat. AKA mut-8.Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat.Mutator.
|
|
| NL361 |
C. elegans |
gpb-1(pk44) II; pkEx170. Show Description
pkEx170 [gpb-1(+) + rol-6(su1006)]. Rollers. Pick Rollers to maintain. NL361 is homozygous for the gpb-1 deletion allele pk44; this results in an L1 arrest if the larvae has maternally derived GPB-1 or in an early embryonic lethality if there is no maternally derived GPB-1 for the developing embryo. This phenotype is rescued by the extrachromosomal transgene which contains the WT gpb-1 gene.
|
|
| NL3630 |
C. elegans |
pkIs32 III; eri-1(mg366) IV. Show Description
pkIs32[pie-1::GFP::H2B]. RNAi hypersensitive.
|
|
| NL3643 |
C. elegans |
unc-22(st136) IV. Show Description
Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc.
|
|
| NL3847 |
C. elegans |
pkIs1600 I; ruIs32 III. Show Description
pkIs1600 [dpy-30::GFP(truncated) + rol-6(su1006)] I. ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Rollers.
|
|
| NL3908 |
C. elegans |
unc-119(ed3) III; pkIs1641. Show Description
pkIs1641[unc-119(+)]. Non-Unc strain.
|
|
| NL3909 |
C. elegans |
unc-119(ed3) III; pkIs1642. Show Description
pkIs1642[unc-119(+) + R11A8.5(+) + sir-2.1(+)]. Non-Unc strain.
|
|
| NL4005 |
C. elegans |
nxf-1(pk864) V. Show Description
Suppressor of activated Gs. Temperature sensitive allele.
|
|
| NL4110 |
C. elegans |
prg-1 (pk2298) I. Show Description
Superficially wildtype.
|
|
| NL4258 |
C. elegans |
pkIs1330 I; tpa-1(pk1585) dpy-20(e1282) IV. Show Description
pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.
|
|
| NL4266 |
C. elegans |
nucb-1(pk1654) Show Description
|
|
| NL4517 |
C. elegans |
alg-2(ok304) II; pkIs2256. Show Description
pkIs2256 [alg-2::HA + rol-6(su1006)]. Rollers.
|
|
| NL4609 |
C. elegans |
C27H5.7(pk1745) II. Show Description
Right flanking sequence of Tc1: 5'-TATATTCCAGAAA.
|
|
| NL4807 |
C. elegans |
unc-119(ed3) III; pkIs2170 X. Show Description
pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.
|
|
| NL5117 |
C. elegans |
ppw-2(pk1673) I. Show Description
|
|
| NL542 |
C. elegans |
gsa-1(pk75) I; pkEx270. Show Description
pkEx270 [rol-6(su1006) + gsa-1(+)]. pk75 is an L1 larval lethal. The strain segregates Rollers and L1 lethals.
|
|
| NL545 |
C. elegans |
dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Heat-shock conditions are 2 hours at 33C, which results in degeneration of neurons.
|
|
| NL557 |
C. elegans |
dpy-20(e1362) IV; pkIs334. Show Description
pkIs334 [gsa-1(+) + dpy-20(+)]. gsa-1 overexpression. The strain is Egl-c and moves actively.
|
|
| NL585 |
C. elegans |
acy-1(pk301) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.
|
|
| NL587 |
C. elegans |
acy-1(pk311) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.
|
|
| NL5901 |
C. elegans |
pkIs2386. Show Description
pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. YFP expression in the muscles. unc-119 was in the background, but it may have been crossed out.
|
|
| NL594 |
C. elegans |
gpa-12(pk322) X. Show Description
Deletion sequence: Flanking undeleted sequence in uppercase, deleted sequence in lower case: CGGTGAATCTggaaagtccacg . . . aaatgcttatTCACAATGTT .
|
|
| NL597 |
C. elegans |
acy-1(pk384) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
|
|
| NL665 |
C. elegans |
mut-6(st702) IV. Show Description
|
|
| NL705 |
C. elegans |
glc-2(pk55); mut-2(r459) I. Show Description
glc-2(pk55) previously called avm-2(pk55).
|
|
| NL706 |
C. elegans |
mut-2(r459) cap-1(pk56::Tc1) I. Show Description
|
|
| NL708 |
C. elegans |
mut-2(r459) I; cct-1(pk58::Tc1) II. Show Description
TTCTCACA TA ATTCCGATCT. Somewhat Dpyish.
|
|
| NL711 |
C. elegans |
mut-2(r459) I; feb-1(pk61). Show Description
|
|
| NL712 |
C. elegans |
mut-2(r459) I; sem-2(pk64). Show Description
|
|
| NL713 |
C. elegans |
mut-2(r459) I; sox-2(pk65). Show Description
K08A8.2. Location of the insertion: TCACGTATCT TA CATATTATAT.
|
|
| NL714 |
C. elegans |
mut-2(r459) I; sox-3(pk66). Show Description
F40E10.2. Location of the insertion: ATTAATAATA TA ACTATTGAAA.
|
|
| NL716 |
C. elegans |
mut-2(r459) I; sod-4(pk68) III. Show Description
F55H2.
|
|