pkIs32[pie-1::GFP::H2B]. RNAi hypersensitive.

Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc.

pkIs1600 [dpy-30::GFP(truncated) + rol-6(su1006)] I. ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Rollers.

pkIs1641[unc-119(+)]. Non-Unc strain.

pkIs1642[unc-119(+) + R11A8.5(+) + sir-2.1(+)]. Non-Unc strain.

Suppressor of activated Gs. Temperature sensitive allele.

Superficially wildtype.

pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.

pkIs2256 [alg-2::HA + rol-6(su1006)]. Rollers.

Right flanking sequence of Tc1: 5'-TATATTCCAGAAA.

pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.

pkEx270 [rol-6(su1006) + gsa-1(+)]. pk75 is an L1 larval lethal. The strain segregates Rollers and L1 lethals.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Heat-shock conditions are 2 hours at 33C, which results in degeneration of neurons.

pkIs334 [gsa-1(+) + dpy-20(+)]. gsa-1 overexpression. The strain is Egl-c and moves actively.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.

pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. YFP expression in the muscles. unc-119 was in the background, but it may have been crossed out.

Deletion sequence: Flanking undeleted sequence in uppercase, deleted sequence in lower case: CGGTGAATCTggaaagtccacg . . . aaatgcttatTCACAATGTT .

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.

glc-2(pk55) previously called avm-2(pk55).

TTCTCACA TA ATTCCGATCT. Somewhat Dpyish.

K08A8.2. Location of the insertion: TCACGTATCT TA CATATTATAT.

F40E10.2. Location of the insertion: ATTAATAATA TA ACTATTGAAA.

F55H2.

ZK112.7. Insertion sequence: TGGAGATACG TA GGTTTTTGAT.

C08H9.5 Previously called tkr-1.

T17E9.1

Tc1 allele.

K08A8.1 Previously called kin-17(pk97).

Dpyish. Primers used to isolate pk209 are: cgatcctcgacagtttgaactgc & cgagattcagggcatgtctatgc.

[NOTE: (07/16/2015) The correct genotype of this strain is gpa-14(pk347) I. not gpa-14(pk342) as previously reported.]

Homozygous prk-2 deletion allele.

Molecular null. No morphological changes. Wild type locomotion and egg laying.

F07B10.1 TAAACAACTT GATCCAATTC. Df.

Mutator strain. Throws males. See WBG 14(2): 24. Strain has a ts phenotype: dies out at 25C, grows at 20C, but best kept at 18-20C. Not known whether it is the mut-7 allele that is ts or something else.