More Fields
Strain Species Genotype
NL4807 C. elegans unc-119(ed3) III; pkIs2170 X. Show Description
pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.
NL5117 C. elegans ppw-2(pk1673) I. Show Description
NL542 C. elegans gsa-1(pk75) I; pkEx270. Show Description
pkEx270 [rol-6(su1006) + gsa-1(+)]. pk75 is an L1 larval lethal. The strain segregates Rollers and L1 lethals.
NL545 C. elegans dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Heat-shock conditions are 2 hours at 33C, which results in degeneration of neurons.
NL557 C. elegans dpy-20(e1362) IV; pkIs334. Show Description
pkIs334 [gsa-1(+) + dpy-20(+)]. gsa-1 overexpression. The strain is Egl-c and moves actively.
NL585 C. elegans acy-1(pk301) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.
NL587 C. elegans acy-1(pk311) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.
NL5901 C. elegans pkIs2386. Show Description
pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. YFP expression in the muscles. unc-119 was in the background, but it may have been crossed out.
NL594 C. elegans gpa-12(pk322) X. Show Description
Deletion sequence: Flanking undeleted sequence in uppercase, deleted sequence in lower case: CGGTGAATCTggaaagtccacg . . . aaatgcttatTCACAATGTT .
NL597 C. elegans acy-1(pk384) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL665 C. elegans mut-6(st702) IV. Show Description
NL687 C. elegans dcr-1(pk1351)/+ III. Show Description
Heterozygotes are WT and segregate WT and animals with protruding vulvas (dcr-1 homozygotes).
NL705 C. elegans glc-2(pk55); mut-2(r459) I. Show Description
glc-2(pk55) previously called avm-2(pk55).
NL706 C. elegans mut-2(r459) cap-1(pk56::Tc1) I. Show Description
NL708 C. elegans mut-2(r459) I; cct-1(pk58::Tc1) II. Show Description
TTCTCACA TA ATTCCGATCT. Somewhat Dpyish.
NL711 C. elegans mut-2(r459) I; feb-1(pk61). Show Description
NL712 C. elegans mut-2(r459) I; sem-2(pk64). Show Description
NL713 C. elegans mut-2(r459) I; sox-2(pk65). Show Description
K08A8.2. Location of the insertion: TCACGTATCT TA CATATTATAT.
NL714 C. elegans mut-2(r459) I; sox-3(pk66). Show Description
F40E10.2. Location of the insertion: ATTAATAATA TA ACTATTGAAA.
NL716 C. elegans mut-2(r459) I; sod-4(pk68) III. Show Description
F55H2.
NL721 C. elegans cdh-3(pk77) III. Show Description
ZK112.7. Insertion sequence: TGGAGATACG TA GGTTTTTGAT.
NL723 C. elegans mpk-1(pk79) mut-2(r459) I. Show Description
NL724 C. elegans old-1(pk69) III. Show Description
C08H9.5 Previously called tkr-1.
NL726 C. elegans mut-2(r459) I; kin-18(pk71) III. Show Description
T17E9.1
NL728 C. elegans cey-1(pk81) II. Show Description
Tc1 allele.
NL735 C. elegans unc-2(pk95::Tc1) X. Show Description
NL737 C. elegans mut-2(r459) I; mek-1(pk97) X. Show Description
K08A8.1 Previously called kin-17(pk97).
NL742 C. elegans rskn-1(pk209::Tc1) mut-2(r459) I. Show Description
Dpyish. Primers used to isolate pk209 are: cgatcctcgacagtttgaactgc & cgagattcagggcatgtctatgc.
NL746 C. elegans pax-3(pk233) II. Show Description
NL772 C. elegans clp-2(pk323) III. Show Description
NL787 C. elegans gpa-11(pk349) II. Show Description
NL788 C. elegans gpa-14(pk347) I. Show Description
[NOTE: (07/16/2015) The correct genotype of this strain is gpa-14(pk347) I. not gpa-14(pk342) as previously reported.]
NL790 C. elegans gpa-4(pk381) IV. Show Description
NL791 C. elegans prk-2(pk439) I. Show Description
Homozygous prk-2 deletion allele.
NL792 C. elegans gpc-1(pk298) X. Show Description
Molecular null. No morphological changes. Wild type locomotion and egg laying.
NL793 C. elegans gpa-9(pk438) V. Show Description
NL795 C. elegans gpa-7(pk610) IV. Show Description
NL796 C. elegans cln-3.1(pk479). Show Description
F07B10.1 TAAACAACTT GATCCAATTC. Df.
NL797 C. elegans gpa-15(pk477) I. Show Description
NL917 C. elegans mut-7(pk204) III. Show Description
Mutator strain. Throws males. See WBG 14(2): 24. Strain has a ts phenotype: dies out at 25C, grows at 20C, but best kept at 18-20C. Not known whether it is the mut-7 allele that is ts or something else.
NLS1 C. elegans cdc-7(knu709) I. Show Description
CRISPR-engineered deletion removing entire cdc-7 gene. Out-crossed 3x to N2. Reference: Currey HN & Liachko NF. 2019. A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects. microPublication Biology. Jan 3;2019:10.17912.
NM1448 C. elegans jsIs37 rpm-1(js410) V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js410 has linked phenotype of reduced brood size. js410 is an R->Stop at aa 235. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.
NM1455 C. elegans jsIs37 rpm-1(js317) V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js317 is a W->Stop at aa 861. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.
NM1489 C. elegans dhc-1(js319) I; jsIs37 V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope.May be slightly Unc. dch-1 alias sam-11.
NM2040 C. elegans dhc-1(js121) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); jsIs37 V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Heterozygotes are GFP+ in the pharynx. dhc-1 homozygotes are GFP- and sterile or partially sterile pvuls. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP js121 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
NM5402 C. elegans jsSi1579 II; bqSi711 IV. Show Description
jsSi1579 [loxP::rpl-28p::FRT::GFP::his-58 FRT3] II. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.
NM5471 C. elegans jsSi1669 IV. Show Description
jsSi1669 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3’ rpl-28p::FRT::GFP::his-58::FRT3] IV. Single component RMCE landing site on Chr IV adjacent to the site of the commonly used ttTi10882 MosSCi insertion site.
NM5500 C. elegans jsSi1691 II. Show Description
jsSi1691 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3' rpl-28p::FRT::GFP::his-58::FRT3] II. Single component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.
NM5548 C. elegans jsSi1726 II. Show Description
jsSi1726 [loxP myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] II. Single component rapid RMCE landing site on Chromosome II adjacent to ttTi5605. Created from jsSi1579 (and jsSi1706) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
NM5549 C. elegans jsSi1727 I. Show Description
jsSi1727 [mosL::loxP::myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3::mosR] I. Single component rapid RMCE landing site on Chromosome I at jsTi1453. Created from jsTi1453 (and jsSi1710) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.