More Fields
Strain Species Genotype
NL1947 C. elegans acy-1(pk907) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL1999 C. elegans acy-1(pk1279)/dpy-17(e164) III. Show Description
Heterozygotes are WT and segregate Dpys, Wt and arrested larvae that hardly move or pump. Suppressor of activated Gs. sgs-1 also called acy-1.
NL2001 C. elegans gpb-2(pk751) I. Show Description
Flanking sequence: AGTCACTCTT - deletion - GAAGACTACT.
NL2003 C. elegans ric-19(pk690) I. Show Description
pk690 is a deletion allele within the gene C32E8.7. The deletion is stable in the homozygous state and has no obvious phenotype. Can verify the presence/homozygosity of the deletion by PCR using the following primers: AL1: 5'-CGACGACACTCCATTATTCC-3' AR1: 5'-CCAGTCCTGCAAAAATGCTC-3'. A product of about 3.7 kb is obtained from WT worms, while a product of about 1 kb is obtained from NL2003 worms. The deletion has been sequenced and covers position -354 to +2276.
NL2010 C. elegans mut-6(st702) IV; rsd-3(pk2010) X. Show Description
Mut. RNAiR.
NL2013 C. elegans rsd-3(pk2013) X. Show Description
Resistant to feeding dsRNA.
NL2035 C. elegans rsd-6(pk2011) I. Show Description
Tc1 insertion in F16D3.2. Resistant to feeding dsRNA. Sensitive to gonadal injection of dsRNA.
NL2037 C. elegans rsd-3(pk2013) X. Show Description
Tc1 insertion in C34E11.1. Resistant to feeding dsRNA. Sensitive to gonadal injection of dsRNA.
NL2098 C. elegans rrf-1(pk1417) I. Show Description
Homozygous rrf-1 deletion allele. RNAi interference for genes expressed in somatic tissue is lost in rrf-1 deletion mutants.
NL2099 C. elegans rrf-3(pk1426) II. Show Description
Homozygous rrf-3 deletion allele. Increased sensitivity to RNAi when compared to WT animals. Deletion sequence (deletion in lower case letters, flanking undeleted sequence in capital letters): TGCACATATTctacagaatt ------- --------tacccgattaAATGGACAATT (from Plasterk Lab 11/05).
NL2105 C. elegans gpa-3(pk35) odr-3(n1605) V. Show Description
Osm. Odr; defective chemotaxis toward various odors. Reference: Lans H, Rademakers S, Jansen G. Genetics. 2004 Aug;167(4):1677-87.
NL2328 C. elegans dpy-20(e1282) IV; pkIs1269. Show Description
pkIs1269 [gpa-13XS(+) + dpy-20(+)].
NL2330 C. elegans gpa-13(pk1270) V. Show Description
NL2331 C. elegans gpa-16(pk481)/bli-3(e767) I. Show Description
Heterozygotes are WT and segregate WT, blistered, and lethals. pk481 previously called spn-1.
NL242 C. elegans mut-2(r459) I; flp-1(pk41::Tc1) IV. Show Description
TTTAAAACG TA CTTACCTTT
NL243 C. elegans mut-2(r459) I; ZK637.13(pk42) III. Show Description
insertion: TTCTGTGAAC TA TGTCAAAAT
NL244 C. elegans nhr-2(pk43::Tc1) mut-2(r459) I. Show Description
Dpyish.
NL245 C. elegans mut-2(r459) I; elt-2(pk46::Tc1) X. Show Description
Insertion in GGTCAAACG TA AGTTAAAGT.
NL2507 C. elegans pkIs1582. Show Description
pkIs1582 [let-858::GFP + rol-6(su1006)]. Rollers.
NL2511 C. elegans msh-6(pk2504) I. Show Description
Mutator phenotype. Enhanced level of spontaneous mutations (frameshifts and single base pair substitutions). The genomic region that is deleted in NL2511 is from nt 24180-25956 (takes out exon 5 and part of exon 6).
NL2550 C. elegans ppw-1(pk2505) I. Show Description
ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. Multiple polymorphisms in C18E3.7 including a single base deletion in ppw-1 resulting in an early stop codon.
NL2808 C. elegans pxf-1(pk1331)/dpy-20(e1363) IV. Show Description
Pick WT to maintain. The pk1331 allele can be followed by PCR.
NL3161 C. elegans pkIs1330 I; tpa-1(pk1401) dpy-20(e1282) IV. Show Description
pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.
NL3223 C. elegans nxf-1(pk386) V. Show Description
Suppressor of activated Gs. Temperature sensitive allele.
NL3231 C. elegans acy-1(pk484) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL3300 C. elegans rsd-6(pk3300) I. Show Description
Resistant when fed dsRNA. Contains a point mutation at position 7120 (c to t) (W575 STOP).
NL3304 C. elegans rsd-4(pk3304) III. Show Description
Resistant to feeding dsRNA but sensitive to dsRNA injection.
NL3307 C. elegans rsd-2(pk3307). Show Description
Resistant when fed dsRNA. Contains a point mutation at position 13832 (c to t) (R1000 STOP).
NL332 C. elegans gpa-1(pk15) V. Show Description
NL3321 C. elegans sid-1(pk3321) V. Show Description
Resistant to feeding dsRNA but sensitive to dsRNA injection. PKA rsd-8.
NL334 C. elegans gpa-2(pk16) V. Show Description
Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.
NL335 C. elegans gpa-3(pk35) V. Show Description
Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.
NL3400 C. elegans pkIs1604. Show Description
pkIs1604 [hsp-16.2::ATG(A)17GFP::LacZ + rol-6(su1006)]. Rollers.
NL3401 C. elegans pkIs1605. Show Description
pkIs1605 [hsp-16.2p::GFP::LacZ + rol-6(su1006)]. Rollers.
NL344 C. elegans gpb-1(pk44)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT (heterozygotes), L1 arrested animals (pk44 homozygotes), and paralyzed Dpy Uncs (mnC1 homozygotes).
NL348 C. elegans gpa-2(pk16) gpa-3(pk35) V. Show Description
Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.
NL3511 C. elegans ppw-1(pk1425) I. Show Description
ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. The genomic region that is deleted: nt 2479-3982 of C18E3 (intragenic deletion in C18E3.7). This strain was formerly called NL2557.
NL3531 C. elegans rde-2(pk1657) I. Show Description
Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat. AKA mut-8.Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat.Mutator.
NL361 C. elegans gpb-1(pk44) II; pkEx170. Show Description
pkEx170 [gpb-1(+) + rol-6(su1006)]. Rollers. Pick Rollers to maintain. NL361 is homozygous for the gpb-1 deletion allele pk44; this results in an L1 arrest if the larvae has maternally derived GPB-1 or in an early embryonic lethality if there is no maternally derived GPB-1 for the developing embryo. This phenotype is rescued by the extrachromosomal transgene which contains the WT gpb-1 gene.
NL3630 C. elegans pkIs32 III; eri-1(mg366) IV. Show Description
pkIs32[pie-1::GFP::H2B]. RNAi hypersensitive.
NL3643 C. elegans unc-22(st136) IV. Show Description
Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc.
NL3847 C. elegans pkIs1600 I; ruIs32 III. Show Description
pkIs1600 [dpy-30::GFP(truncated) + rol-6(su1006)] I. ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Rollers.
NL3908 C. elegans unc-119(ed3) III; pkIs1641. Show Description
pkIs1641[unc-119(+)]. Non-Unc strain.
NL3909 C. elegans unc-119(ed3) III; pkIs1642. Show Description
pkIs1642[unc-119(+) + R11A8.5(+) + sir-2.1(+)]. Non-Unc strain.
NL4005 C. elegans nxf-1(pk864) V. Show Description
Suppressor of activated Gs. Temperature sensitive allele.
NL4110 C. elegans prg-1 (pk2298) I. Show Description
Superficially wildtype.
NL4258 C. elegans pkIs1330 I; tpa-1(pk1585) dpy-20(e1282) IV. Show Description
pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.
NL4266 C. elegans nucb-1(pk1654) Show Description
NL4517 C. elegans alg-2(ok304) II; pkIs2256. Show Description
pkIs2256 [alg-2::HA + rol-6(su1006)]. Rollers.
NL4609 C. elegans C27H5.7(pk1745) II. Show Description
Right flanking sequence of Tc1: 5'-TATATTCCAGAAA.