More Fields
Strain Species Genotype
NJ683 C. elegans exc-7(rh252) II. Show Description
Excretory canal defect. Canal is invariably short with multiple cysts of varying size clustered along length, especially at the tips. Visible only by Nomarski microscopy. Tail spike is often slightly malformed. Animal is somewhat pale.
NJ831 C. elegans exc-3(rh186) X. Show Description
Excretory canal defect. Hypomorphic allele. Canals are slightly shortened. Defect visible only by Nomarski microscopy.
NJ833 C. elegans exc-6(rh103) III. Show Description
Excretory canal defect. Canal varies in length from no outgrowth to almost complete outgrowth. Frequent small vacuoles and extra branchings in the canal lumen visible only by Nomarski microscopy. Animals are somewhat pale.
NKZ35 C. inopinata Caenorhabditis inopinata wild isolate Show Description
Caenorhabditis inopinata wild isolate; 10x inbred line. Male-Female. Maintain by mating at 25C or above; does not grow well at 20C. See reference for the details d(https://www.nature.com/articles/s41467-018-05712-5). Sibling species of C. elegans. Inbred 10 times, full genome sequence available. Frozen stock recovery is lower efficiency than C. elegans with glycerol; DMSO method works more efficiently. Adult: Large and slender species; ca. 1.5–2.5?mm in length, and individuals may reach up 3.0?mm under optimal culturing conditions. Cuticle is moderate to thick with four-lined lateral field. Deirids on the lateral field, at the level slightly behind the secretory–excretory pore. Lip separated into six sectors, not clearly offset. Six labial sensilla and four cephalic sensilla present. The anterior end of each lip sector very slightly elongated and forming six stomatal flaps. Amphid small, oval pore-like, at the level of the margin of cheilo and gymnostom. Tube-like stoma separated into three parts; short tube-like cheilostom; simple tube-like gymnostom, which is weakly separated into two subsections; and tube-like stegostom covered by pharyngeal sleeve, which is separated into four subsections, prostegostom, mesostegostom, metastegostom, and telostegostom. Metastegostomatal three teeth flap-like. Pharynx separated into four sections; procorpus forming muscular tube, well-developed metacorpus (median bulb); glandular and narrow isthmus; and basal bulb with double haustrulum as the glottoid apparatus. Pharyngo-intestinal valve (cardia) prominent. Nerve ring around the middle of isthmus. Excretory pore located around the margin of isthmus and basal bulb. Female: Gonadal system didelphic, amphidelphic. Anterior and posterior gonadal system are basically symmetric with each other, arranged as ovary, oviduct, spermatheca, spermathecal-uterus junction tissue, uterus and vulva/vagina from distal. Sometimes more than 20 developing eggs are deposited. Tail conical or forming slightly elongated conus with pointed tip. Anus and rectum clearly visible; three (two subventral and one dorsal) rectal glands present. Phasmid forming small pore at ca. 60% of total tail length from anus. Male: Testis single, anteriorly reflexed rightwardly. Vas deferens occupying ca. 1/5 of total gonadal length. Tail enveloped by a closed bursa, supported by nine pairs of bursal rays. Anterior cloacal lip with a rounded and sclerotized appendage and bulge-like appendage between rounded appendage and cloacal opening; a small sensilla-like papilla on the bulge-like appendage. Posterior cloacal lip with tongue-like appendage with two cloacal sensilla. Spicules paired, separate, long and slender with evenly slightly ventrally curved blade and simply pointed tip. Gubernaculum slender, ventrally arcuate with small squared appendage at the distal end in lateral view. Bursa heart-shaped in ventral view, anteriorly closed with serrated edge; serratae obvious in anterior half and vague in posterior half; terminal notch present but unclear. The nine pairs of genital papillae or bursal rays supporting the bursal velum with an arranged (2/1?+?1?+?2?+?3).
NL1000 C. elegans cdh-3(pk87) III. Show Description
2.6 kb deletion. pk87 homozygotes have a variable defect in hyp10 morphogenesis; most obvious in L1-L2 larvae. Rescued by WT copy of cdh-3 present on cosmid ZK112.
NL1100 C. elegans mut-2(r459) I; prk-1(pk86::Tc1) III. Show Description
Insertion in CCTTCAGAAG TA TGTCATTTGG.
NL1106 C. elegans prk-2(pk278) III. Show Description
Deletion between: (exon 2): CCCAGAAGGCTT and (intron 4): ATATATATATATAGAC (complex rearrangement in between).
NL1136 C. elegans mut-2(r459) I; gpa-5(pk375) X. Show Description
NL1137 C. elegans gpa-5(pk376) X. Show Description
NL1140 C. elegans dpy-20(e1282) IV; pkIs379. Show Description
pkIs379 [gpa-5XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.
NL1142 C. elegans gpa-8(pk345) V. Show Description
NL1146 C. elegans gpa-6(pk480) X. Show Description
NL1147 C. elegans gpa-10(pk362) V. Show Description
NL1236 C. elegans acy-1(pk393) III; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
NL1242 C. elegans acy-2(pk465) V; pkEx467. Show Description
pkEx467 [acy-2(+) + rol-6(su1006)]. pk465 was isolated from a chemical deletion library and has a deletion of the first catalytic domain and the two multiple transmembrane regions of the predicted ACY-2 protein. The phenotype of pk465 is early larval lethality. The lethal phenotype of pk465 is rescued in NL1242 by a transgene containing WT acy-2 (cosmid C10F3) and rol-6.
NL130 C. elegans pgp-1(pk17) IV; pgp-3(pk18) X. Show Description
Drug sensitive. No visible phenotype. pgp-1 and pgp-3 deletion alleles.
NL131 C. elegans pgp-3(pk18) X. Show Description
pgp-3 deletion allele. No visible phenotype. Drug sensitive (colchicine, chloroquine). Throws males: outcrossed with him-8(e1489) so probably contains this mutation.
NL132 C. elegans pgp-1(pk17) IV. Show Description
pgp-1 deletion allele. No visible phenotype. Might be sensitive to drugs.
NL147 C. elegans mrp-1(pk89) Show Description
mrp-1 deletion mutant. WT under normal lab conditions. Sensitive to cadmium and arsenite.
NL152 C. elegans pgp-1(pk17) IV; pgp-3(pk18) X; mrp-1(pk89) Show Description
pgp-1, pgp-3 and mrp-1 triple deletion mutant. Hypersensitive to cadmium and arsenite.
NL1533 C. elegans dpy-20(e1282) IV; pkIs533. Show Description
pkIs533[gpa-10XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.
NL1581 C. elegans dpy-20(e1282) IV; pkIs503. Show Description
pkIs503[gpa-1XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.
NL1584 C. elegans dpy-20(e1282) IV; pkIs515. Show Description
pkIs515 [gpa-4XS(+) + dpy-20(+)]. Not known to which LG the insertion is attached.
NL1585 C. elegans dpy-20(e1282) IV; pkIs519. Show Description
pkIs519 [gpa-6XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.
NL1586 C. elegans dpy-20(e1282) IV; pkIs523. Show Description
pkIs523 [gpa-7(+) + dpy-20(+)].
NL1587 C. elegans dpy-20(e1282) IV; pkIs527. Show Description
pkIs527 [gpa-8XS(+) + dpy-20(+)]. Not know to which LG the insertion is attached.
NL1588 C. elegans dpy-20(e1282) IV; pkIs531. Show Description
pkIs531[gpa-9XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.
NL1590 C. elegans dpy-20(e1282) IV; pkIs539. Show Description
pkIs539 [gpa-11(XS)(+) + dpy-20(+)]. Not know to which LG the insertion is attached.
NL1593 C. elegans dpy-20(e1282) IV; pkIs552. Show Description
pkIs552[gpa-14XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.
NL1594 C. elegans dpy-20(e1282) IV; pkIs555. Show Description
pkIs555 [gpa-15XS(+) + dpy-20(+)]. Not know to which LG the insertion is attached.
NL1598 C. elegans dpy-20(e1282) IV; pkIs571. Show Description
pkIs571[gpc-1XS dpy-20(+)]. No morphological changes. Locomotion and egg laying are slightly reduced.
NL1603 C. elegans dpy-20(e1282) IV; pkIs583. Show Description
pkIs583 [gpa-6::GFP + dpy-20(+)]. GFP expression in AWA, ASI and PHB. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
NL1604 C. elegans dpy-20(e1282) IV; pkIs584. Show Description
pkIs584 [gpa-7::GFP + dpy-20(+)]. GFP expression in many neurons, muscle cells, and many neurons in the male tail.
NL1606 C. elegans dpy-20(e1282) IV; pkIs586. Show Description
pkIs586 [gpa-9::GFP + dpy-20(+)]. GFP expression in ASJ, PHB, PVQ, pharynx muscle and spermatheca.
NL1607 C. elegans dpy-20(e1282) IV; pkIs587. Show Description
pkIs587 [gpa-10::GFP + dpy-20(+)].
NL1609 C. elegans dpy-20(e1282) IV; pkIs589. Show Description
pkIs589 [gpa-13::GFP + dpy-20(+)]. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
NL161 C. elegans pkEx589. Show Description
pkEx589 [mrp-1::lacZ + rol-6(su1006)]. Rollers. Maintain by picking Rol.
NL1610 C. elegans dpy-20(e1282) IV; pkIs590. Show Description
pkIs590 [gpa-14::GFP + dpy-20(+)]. GFP+.
NL1611 C. elegans dpy-20(e1282) IV; pkIs591. Show Description
pkIs591[dpy-20(+) + gap-15::GFP]. GFP expression in ADL, ASH, ASK, PHA, PHB, distal tip cell, anchor cell, and many male-specific neurons.
NL1800 C. elegans mut-16(pk700) I. Show Description
NL1810 C. elegans mut-16(pk710) I. Show Description
NL1820 C. elegans mut-7(pk720) III. Show Description
Mutator. Flanking sequence: gatttatccattttcaatcca cattttggatggtaaattctca.Mutator.
NL1832 C. elegans T24C4.1(pk732) III. Show Description
NL1834 C. elegans mut-9(pk734) Show Description
Mutator.
NL1838 C. elegans mut-14(pk738) Show Description
Mutator strain. TS. RNAi defect. TATTCTGGAC A AAGCTGATAA.
NL1888 C. elegans pash-1(pk2083)/+ I; pkIs2084. Show Description
pkIs2084 [col-10::LacZ::lin-41 + goa-1::GFP]. Heterozygous. pash-1(pk2083)/+ heterozygotes look wild-type and will segregate pash-1(pk2083)/+ heterozygotes, sterile pk2083 homozygotes, and wild-type. Pick wild-type heterozygotes and check for segregation of sterile progeny to maintain.
NL1908 C. elegans acy-1(pk866) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL1909 C. elegans acy-1(pk867) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
NL1921 C. elegans acy-1(pk880) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL1925 C. elegans acy-1(pk884) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.