More Fields
Strain Species Genotype
LP870 C. elegans cpSi172 I. Show Description
cpSi172 [myo-2p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in the pharynx.
LP871 C. elegans cpSi174 I. Show Description
cpSi174 [myo-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in body wall muscle.
LSC59 C. elegans nlp-37(tm4393) X; lstEx24. Show Description
lstEx24 [pdf-2p::pdf-2::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. lst24 rescues pdf-2; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.
LSD1097 C. elegans smg-1(cc546) I; xchEx97. Show Description
xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
LV18 C. elegans unc-45(wc1) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (dauer escapers will be Par and give only dead eggs), and DpyUcs which arrest as dead eggs (range from twitching multicellulars to 3-folds that hatch). [There is a greater percentage of hatchlings when the mother is heterozygous (wc1 dpy-1/+). There may also be the possibility of near complete maternal rescue (near full-sized, sterile Dpys), but this has not been routinely observed in the balanced strain (as opposed to wc1 dpy-1/+).] Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: The dauers are not giving dead eggs-they are giving other dauers. Appears that the Par mutation is no longer present.]
LV19 C. elegans unc-45(wc2) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (escapers will be Par and give only dead eggs) and DpyUncs which are dead eggs (a range of embryonic lethality from multicellular twitchers to 3-folds that do not hatch). Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: the dauers are giving dead eggs.]
LW709 C. elegans jjIs709 I. Show Description
jjIs709 [(pDRNL1) + lmn-1p::GFP::lmn-1::unc-54 3'utr + (pMH86) dpy-20(+)] I. GFP-tagged LMN-1 is expressed in all somatic cells. Reference: Haithcock E, et al. (2005) PNAS 102:16690-5.
LX2004 C. elegans vsIs183 lite-1(ce314) lin-15B&lin-15A(n765) X. Show Description
vsIs183 [nlp-3p::GCaMP5::nlp-3 3'UTR + nlp-3p::mCherry::nlp-3 3'UTR + lin-15(+)] X. Integrated transgene using nlp-3 promoter to drive GCaMP5 and mCherry expression in HSN; useful for visualizing and quantitating calcium influx in HSN. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
LX677 C. elegans rgs-7(vs98)/unc-1(n496) lon-2(e678) X. Show Description
Heterozygotes are Unc but not Lon. n496 is dominant. Segregates LonUnc. vs98 homozygotes are non-Unc, non-Lon and are Mel (they give only dead eggs). Strain will break down due to recombination so check for the presence of vs98 by PCR every few generations. Received new stock Feb 2005.
MD4195 C. elegans unc-119(ed3) III; bcSi69 IV. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. [NOTE: MD4195 can be maintained at 20C instead of 15C because it does not carry an array with guide RNAs targeting essential genes.] Generated in parental strain EG8081. Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4571 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1367. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1367 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1367 array contains a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4572 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1368. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1368 [U6p::rrn-1(sgRNAs1-4 targeting the rrn-1 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1368 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4574 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1370. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1370 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-1 locus) + U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1370 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I) and a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MDH33 C. elegans otIs339; otIs355. Show Description
otIs339 [ceh-43(+)(fosmid)::GFP + ttx-3::DsRed + rol-6(su1006)]. otIs355 [rab-3::NLS::tagRFP]. Rollers.
MDH38 C. elegans ast-1(gk463) bli-2(e768) unc-4(e120) II; otIs339; otIs355; norEx42. Show Description
otIs339 [ceh-43(+)(fosmid)::GFP + ttx-3::DsRed + rol-6(su1006)]. otIs355 [rab-3::NLS::tagRFP]. norEx42 [ast-1 Cosmid + ttx-3::GFP + dat-1::mCherry]. Rollers. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.
MG8 C. elegans csc-1(t1171) dpy-2(e8)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and Dpys which give only dead eggs. Throws males.
MIR23 C. elegans risIs3. Show Description
risIs3 [K02A4.1p::K02A4.1::GFP + unc-119(+)]. Superficially wild-type. GFP mainly in head region and body wall muscle. Reference: Mansfeld J, et al. Nat Commun, 2015 Dec 1;6:10043.
MIR249 C. elegans risIs33. Show Description
risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511.
MIR250 C. elegans hif-1(ia4) V; risIs33. Show Description
risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and ZG31.
MIR251 C. elegans hsf-1(sy441) I; risIs33. Show Description
risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and PS3551.
MIR276 C. elegans risIs33; gpIs1. Show Description
risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and TJ375.
MKE243 C. elegans lin-45(cov37[gfp::3xFLAG::lin-45]) IV. Show Description
GFP::3xFLAG tags inserted at N-terminus of endogenous lin-45 locus. Wild-type morphology. Reference: Townley R, et al. Sci Signal. 2023 Aug 29;16(800):eabq4355. doi: 10.1126/scisignal.abq4355. PMID: 37643243.
ML855 C. elegans +/szT1 [lon-2(e678)] I; ppk-3(mc46)/szT1 X. Show Description
Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon males, mc46 hemizygotes (WT males) and mc46 homozygotes. mc46 is a deletion that results in homozygotes which show enlarged vacuoles (late endosomes and lysosomes) and lay eggs with enlarged vacuoles that die at different stages of embyronic development.
MLC1480 C. elegans lucIs39. Show Description
lucIs39 [tbx-37p::mNeonGreen::2xNLS::tbx-37 3'UTR + pal-1p::mScarlet-I::2xNLS::tbb-2 3'UTR + med-2p::mScarlet-I::2xNLS::tbb-2 3'UTR]. Wild-type morphology. Integrated array allows for labeling and sorting of ABa and ABp descendants by FACS. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
MQ200 C. elegans mud-1(qm21) III. Show Description
Maternal effect Uncoordinated and Dumpy. High degree of embryonic and larval lethality. Dpy phenotype only partially resuced. Hatchlings are of variable length, with poor movement. Adults are short and show kinky uncoordination.
MQ468 C. elegans hmp-2(qm39) I. Show Description
Maternally rescued Dpy. Fully zygotically rescued but only partially maternally rescued. Some embryonic lethality and a high degree of larval lethality. Very poor embryonic elongation. Hatchlings are short and deformed. In later stages the anterior half of the body is short but well developed while the posterior is thin.
MQD1779 C. elegans daf-2(hq63[daf-2::ICR::NLS::gfp::mNeonGreen::NLS]) III. Show Description
Nuclear Ultrabright GFP::mNeonGreen Fluorescent protein (NuGFP) tag inserted downstream of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. NuGFP cassette is composed of an intercistronic region (ICR) from the C. elegans SL2-type operon, a SV40 nuclear localization sequence (NLS), the coding sequence of GFP, the coding sequence of mNeonGreen, and egl-13 NLS. The expression of NuGFP is tied to that of the endogenous daf-2, but after trans-splicing, the NuGFP protein is synthesized independently of DAF-2. This high-sensitivity daf-2 expression reporter was readily detectable in most C. elegans cells throughout development and adulthood. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MS438 C. elegans irIs25 V. Show Description
irIs25 [elt-2::NLS::GFP::lacZ + rol-6(su1006)] V.
MSB273 C elegans syIs423 V; mirIs19. Show Description
syIs423 [15xUAS::?pes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)]. mirIs19 [nlp-12p::gal-4 + unc-122p::mCherry]. Maintain animals at 25C for several generations to enhance mKate expression in DVA to make it visible with a fluorescence dissection scope. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
MSB778 C elegans mirIs71. Show Description
mirIs71 [nlp-12p::CRE + myo-2p::mCherry]. DVA-specific CRE driver. Superficially wild-type. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
MT1122 C. elegans sup-11(n403) I; unc-93(e1500) III. Show Description
Phenotype: small, scrawny, thin, lays few eggs. unc-93(e1500) rubberband phenotype is completely suppressed by sup-11(n403) so only sup-11 phenotype is visible. n403 is semidominant.
MT1373 C. elegans lin-13(n387)/unc-32(e189) III; him-5(e1467) V. Show Description
Maintain by picking wild-type animals raised at 25C. Heterozygotes will be wild-type and segregate wild-type, Unc, Sterile Muv, and males. The phenotype of homozygous lin-13 hermaphrodites segregating from a heterozygous mother depends on the temperature at which the strain was grown. At 25C, homozygous hermaphrodites segregating from a heterozygote are both Muv and sterile. At 20C, ~1/2 of hermaphrodites segregating from a heterozygote are sterile, but only a few are Muv. At 15C, hermaphrodites segregating from a heterozygote are almost wild type in appearance and fertility. However, if the progeny of these 15C animals are grown at 15C, all are sterile and some are Muv. If the progeny of these 15C animals are grown at 25C, then some animals arrest during larval growth and the rest are both sterile and Muv. The male phenotype similarly is heat sensitive; only males that are the progeny of lin-13 hermaphrodites and are grown at 20C or 25C have ventral protrusions. Reference: Ferguson EL & Horvitz HR. Genetics. 1985 May;110(1):17-72. PMID: 3996896.
MT14531 C. elegans prg-2(nDf57) IV. Show Description
Deletion breakpoints: ATCGGGATGAAGTTTGCAAA//AATCTAGAATACCGATTTCG. Transposon silencing abnormal. Only enhanced transposon activity observed in n4503; nDf57 mutants compared to n4503 (not in nDf57 mutants alone).
MT15695 C. elegans nIs175 IV; ceh-34(4796) V. Show Description
nIs175 [ceh-28p::4xNLS::GFP + lin-15(+)] IV. Extra GFP+ M4 observed in nIs175. Reference: Takashi H, et al. PNAS 2010 Aug 31;107(35):15479-84.
MT16231 C. elegans nIs177 sptf-3(n4850) I. Show Description
nIs177 [ceh-28p::4NLS::GFP + lin-15(+)]. Extra ceh-28p::4NLS::GFP-expressing M4 seen in nIs177 (~30% penetrance). Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
MT18778 C elegans nIs348 IV; lin-15AB(n765) X. Show Description
nIs348 [ceh-28p::4XNLS::mCherry + lin-15(+)] IV. Reporter construct contains 2.4 kb of ceh-28 promoter. Reference: Hirose T, et al. Proc Natl Acad Sci. 2010 Aug 31;107(35):15479-84. PMID: 20713707
MT19110 C. elegans nIs363 X. Show Description
nIs363 [D2096.6 (1.7kb UP)::pes-10::4xNLS::GFP + lin-15AB(+)]. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27 [NOTE (Aug 2019): the nIs363 trasngene in this strain was previously described as nIs363 [D2096.6 (1.7kb UP)::4xNLS-GFP] X.]
MT19372 C. elegans sptf-3(n4850) I; nIs283 X. Show Description
nIs283 [gcy-10p::4xNLS::GFP + lin-15(+)]. gcy-10p::4xNLS::GFP is expressed in I1 neurons. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15; 500(7462): 354-358.
MT19454 C. elegans nIs396 V. Show Description
nIs396 [sams-5 3'::4xNLS-GFP + lin-15(+)] V. GFP expression in MI. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27
MT19851 C. elegans sptf-3(tm607)/hIn1 [unc-101(sy241)] nIs425 I; nIs175 IV. Show Description
nIs425 [myo-2p::GFP] I. nIs175 [ceh-28p::4NLS::GFP + lin-15(+)] IV. Heterozygotes are GFP+ wild type and segregate GFP+ Unc, GFP+ wild type, and GFP- sptf-3 homozygotes. nIs425 was integrated into sptf-3(tm607)/hIn1[unc-101(sy241)] I. The position of integration appears to be close to or lie within the region covered by hIn1: sptf-3(tm607) heterozygotes are GFP+ whereas sptf-3(tm607) homozygotes do not express GFP in the pharynx. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
MT3126 C. elegans mut-2(r459) I; dpy-19(n1347) III. Show Description
Very mildly Dpy Tc1-induced dpy-19 allele. Generates severe Dpys when Tc1 hops out of dpy-19 (doesn't excise cleanly). See also WBPaper00001672. [Some concern whether the Mut phenotype in this strain is actually mut-2 because it showed no transposition of Tc3 or other Tc's besides Tc1. 1/95.]
MT6984 C. elegans exc-9(n2669) IV. Show Description
Wide, meandering excretory canals, with some septate fluid-filled cysts. Canal enlargement visible from L1 through adult. Defect visible only by Nomarski microscopy. n2669 was originally listed as an allele of exc-5. Later repeated complementation tests showed n2669 to be an allele of a novel locus positioned close to exc-5.
MT706 C. elegans lin-13(n388)/unc-32(e189) III. Show Description
Maintain by picking wild-type animals raised at 25C. Heterozygotes will be wild-type and segregate wild-type, Unc, and Sterile Muv. The phenotype of homozygous lin-13 hermaphrodites segregating from a heterozygous mother depends on the temperature at which the strain was grown. At 25C, homozygous hermaphrodites segregating from a heterozygote are both Muv and sterile. At 20C, ~1/2 of hermaphrodites segregating from a heterozygote are sterile, but only a few are Muv. At 15C, hermaphrodites segregating from a heterozygote are almost wild type in appearance and fertility. However, if the progeny of these 15C animals are grown at 15C, all are sterile and some are Muv. If the progeny of these 15C animals are grown at 25C, then some animals arrest during larval growth and the rest are both sterile and Muv. Reference: Ferguson EL & Horvitz HR. Genetics. 1985 May;110(1):17-72. PMID: 3996896.
MT7531 C. elegans ppk-3(n2835) X. Show Description
n2835 animals show enlarged vacuoles in intestine, epidermis, coelomocytes and pharynx.
N2 (ancestral) C. elegans C. elegans wild type (anCestral). Show Description
WT C. elegans. From Cambridge collection-originally frozen around 1968: In 1980, in order to establish an ancestral stock, Jonathan Hodgkin thawed one of the earliest frozen tubes of N2, dating from 1968. From this plate J.H. grew up a population en masse (without subculturing) on NGM plates (about 2 generations). Multiple samples of this were frozen in order to provide a reference N2 stock. This set of stock samples was replenished by regrowth in 1985 and 1991, using the same procedure, and a freshly thawed sample was sent to the CGC in 1993. Thus, samples from this frozen stock, called N2 (ancestral), should be only about 6 generations away from the stock used by Sydney Brenner as his standard WT N2. [Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966.] Caenorhabditis elegans wild isolate. Note: N2 (ancestral) has reduced lifespan and fertility relative to the standard CGC N2 strains. See Worm Breeder's Gazette 16(5): 24 (February 1,2001).
NC3182 C. elegans otIs181 III; otIs138 X; otIs396. Show Description
otIs181[dat-1::mCherry + ttx-3::mCherry] III. otIs138[ser-2(prom3)::GFP + rol-6(su1006)] X. otIs396 [ace-1prom2::NLS::tagRFP]. Rollers. dat-1::mCherry labels ADE, CEP, and PDE neurons. ttx3::mCherry labels AIY neurons. ser-2(prom3)::GFP labels OLL, PDE, and PVD neurons. ace-1prom2::NLS::tagRFP labels CEP and OLL neurons. PVD can be identified by expression only GFP. An additional pair of GFP-only cells anterior to OLL are occasionally observed in this strain. Can be used to isolate PVD by FACS (green-only). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). Reference: Barbara O’Brien (2017) Diverse genetic and transcriptional programs mediate dendritic development of a nociceptor neuron. Ph.D Dissertation, Vanderbilt University. (https://ir.vanderbilt.edu/handle/1803/14489?show=full)
NC3296 C. elegans ynIs37 III; juIs223 IV. Show Description
ynIs37 [flp-13::GFP] III. juIs223 [ttr-39p::mCherry + ttx-3p::GFP] IV. ttr-39::mCherry alone marks VD and DD neurons. ttx-3::GFP marks AIY neurons. Combined ttr-39::mCherry and flp-13::GFP co-expression marks DD neurons in the L2 (only a few mCherry+/GFP+ DD neurons will show up briefly in the L2 stage and gene silencing apparently dims the GFP marker over time). VD neurons can be identified by mCherry alone, no GFP. Derived by crossing parental strains CZ8332 and NY2037. Can be used to isolate VB neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
NC3577 C. elegans ufIs26 II; otIs707. Show Description
ufIs26 [unc-4p::mCherry + lin-15(+)] II. otIs707 [bnc-1p(1.8kb)::GFP]. VB neurons are GFP+ only; VA and SABV have both mCherry and GFP. Can be used to isolate VB neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
NC4085 C. elegans otIs355 IV; otIs846. Show Description
otIs355 [rab-3p(prom1)::2xNLS::TagRFP] IV. otIs846 [egas-1p::GFP + unc-122p::GFP]. Pan-neuronal nuclear RFP expression. Co-expression of GFP and RFP in IL2 neuron can be used to isolate IL2 by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
NFB2057 C. elegans fkh-8(vlc43) II; otIs395. Show Description
otIs395 [ift-20p::NLS::tagRFP + pha-1(+)]. Ciliome defects. CRISPR-engineered fkh-8 null mutation. Reference: Brocal-Ruiz R, et al. Elife. 2023 Jul 14;12:e89702. doi: 10.7554/eLife.89702. PMID: 37449480.