More Fields
Strain Species Genotype
KG4687 C. elegans ceIs269 I. Show Description
ceIs269 [unc-129p::tomm-20::Venus + unc-129p::mCherry + ttx-3p::RFP]; Integration in Chromosome I (near genetic position -3.20 or 1.14). The ttx-3 marker is quite faint in this strain especially in larvae. The tomm-20::Venus construct was injected at 0.5 ng/ ul in the strain used to make this integrant, so virtually all of the visible tomm-20::Venus signal s associated with mitochondria with essentially no background. The unc-129p::mCherry marker is expressed at a very low level that are detectable only with a sensitive camera (and often not by eye at 1000X). In strains lacking mitochondria in the dorsal cord, use the camera to focus on the mCherry in the dorsal cord, then acquire in the YFP channel.
KK28 C. elegans unc-4(e120) mel-17(b299)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Strict maternal effect.
KK299 C. elegans par-5(it55) unc-22(e66) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, Twitchers which give only dead eggs, and dead eggs. nT1 heterozygotes are shorter and slower than par-5 unc-22 homozygous worms. par-5 region is not well balanced by nT1: check to make sure that unc-22 homozygotes lay dead eggs. Strict maternal effect lethal.
KK332 C. elegans mel-11(it26) unc-4(e120) sqt-1(sc13)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, and UncRol (which give only dead eggs). Maintain by picking WT. mel-11 is not strict. See also WBPaper00002726.
KK338 C. elegans mel-10(it10) unc-4(e120) sqt-1(sc13)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Strict maternal effect.
KK34 C. elegans unc-4(e120) mel-16(b298)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT.
KK352 C. elegans unc-4(e120) top-2(it38)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Not a strict maternal effect-rescued by male mating.
KK356 C. elegans mel-4(it12) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs (it12 is temperature sensitive). Maintain by picking WT. Strict maternal effect.
KK357 C. elegans mel-1(it19) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Strict maternal effect.
KK359 C. elegans tofu-6(it20) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Strict maternal effect.
KK366 C. elegans mel-7(it36) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Strict maternal effect.
KK37 C. elegans mel-5(b314) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs (0.5% leaky). Maintain by picking WT. Not a strict maternal effect.
KK375 C. elegans mel-12(it42) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Not a strict maternal effect-rescued by male mating.
KK40 C. elegans mel-3(b281) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Strict maternal effect.
KK41 C. elegans unc-4(e120) mel-20(b317)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Not a strict maternal effect-rescued by male mating.
KK436 C. elegans unc-4(e120) mel-14(it24)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs (approx .2% leaky). Maintain by picking WT.
KK49 C. elegans unc-4(e120) mel-18(b300)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Not a strict maternal effect-rescued by male mating.
KK571 C. elegans lon-1(e185) par-3(it71)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles, and Lon which give only dead eggs.
KK818 C. elegans par-6(zu222) unc-101(m1)/hIn1 [unc-54(h1040)] I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc, and Coilers which give only dead eggs (slightly leaky, but survivors are agametic). zu222 is a strict maternal effect embryonic lethal. Partitioning defect similar to that of par-3; fails to localize PAR-3 protein.
KP3947 C. elegans nuIs183. Show Description
nuIs183 [unc-129p::nlp-21::Venus + myo-2p::GFP]. [NOTE: nuIs183 was previously described as carrying myo-2p::NLS::GFP.] Reference: Sieburth D, et al. Nat Neurosci. 2007 Jan;10(1):49-57.
KP3957 C. elegans nuIs190 X. Show Description
nuIs190 [unc-129p::ins-22::Venus + myo-2p::NLS::GFP] X. Pick GFP+ to maintain. Not all animals express GFP. Array might be prone to silencing or not homozygous. [NOTE: nuIs190 was previously described as carrying myo-2p::GFP without an NLS.] Reference: Ch'ng Q, Sieburth D, Kaplan JM. PLoS Genet. 2008 Nov;4(11):e1000283.
KR1504 C. elegans let-545(h842) dpy-5(e61) unc-13(e450) I; (rh??) X?; sDp2 (I;f). Show Description
Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h842 arrests as a sterile adult, and the unlinked mutation results in a tumorous gonad phenotype). Maintain by picking Unc-13 and checking for correct segregation of progeny.
KR1557 C. elegans hDf10 dpy-5(e61) unc-29(e403)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. Show Description
Wild-type to mildly long phenotype, sometimes a bit Unc. Segregates wild-type, Dpy-18 (hT2[dpy-18 bli-4] homozygotes), hDf10 dpy-5 unc-29 homozygotes (probably dead eggs) and large numbers of aneuploids (dead eggs). dpy-18(h662) completely suppresses bli-4(e937), is only very mildly Dpy, and has a distinctive dark body and large clear vulval region as a young adult, before becoming gravid. Do not passage: hT2 homozygotes seem somewhat healthier than the het, and will overgrow the plate. Pick longish wild-types and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KRA315 C. elegans kasIs7. Show Description
kasIs7 [snb-1p::C9 ubi + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of snb-1 promoter. The repeats are flanked with human C9orf72 intronic sequences. Reference: https://pubmed.ncbi.nlm.nih.gov/34654821/
KRA317 C. elegans kasIs9. Show Description
kasIs9 [snb-1p::(delta)C9 ubi + myo-2::GFP]. The transgene has the snb-1 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: https://pubmed.ncbi.nlm.nih.gov/34654821/
KW2194 C. elegans ckSi17 I; unc-119(ed3) III. Show Description
ckSi17 [cdk-12::GFP::mex-5 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).
KW2195 C. elegans ckSi20 II; unc-119(ed3) III. Show Description
ckSi20 [cdk-9::mCherry::mex-5 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).
KW2196 C. elegans ckSi21 II; unc-119(ed3) III. Show Description
ckSi21 [cdk-9::GFP::pal-1 3'UTR + unc-119(+)] II. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).
KW2205 C. elegans cdk-9(tm2884) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); ckSi21 II. Show Description
ckSi21 [cdk-9::mCherry::pal-1 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. hT2 segregates WT green-glowing heterozygotes and non-GFP cdk-9 homozygotes (normally arrest as L1-L2 larvae; cdk-9 homozygotes carrying ckSi21 (GFP- mCherry+) are viable but sterile. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).
KW2206 C. elegans ckSi26 I; unc-119(ed3) III. Show Description
ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).
KW2211 C. elegans ckSi26 I; cdk-12(ok3664)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Throws heterozygous Rollers, tm3846 homozygotes (Emb), and tm3846 homozygotes (arrest as L1-L2 larvae). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. qIs26 is an integration of qEx233. Reference: Bowman EA, et al. Development. (In Press).
KX54 C. elegans ifg-1(cxTi9279) II; bcIs39 V. Show Description
bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Temperature-sensitive germ cell apoptosis leading to infertility at 25 C. Apoptosing germ cells are decorated by CED-1::GFP in the gonad. Loss of p170 form of IFG-1 (but not p130 IFG-1) confirmed by Western blot. Escaping eggs are fertilized and embryonic lethal. Mos-1 transposon insertion previously described as ifg-1::mos-1(cxP9279) II; confirmed by triple primer PCR with 5’-ACCAAACTGGGCAAACAAAG-3’, 5’-GCTCAATTCGCGCCAAACTATG-3’, and 5’-CTTCCTGAAATTTGGTTTAACAGT-3’. Homozygous ifg-1::mos yields only 444 bp product. Outcrossed heterozygotes yield both 353 bp (wild type ifg-1) and 444 bp products.
KX84 C. elegans ced-3(n2452) IV; bcIs39 V. Show Description
bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Resistant to germ cell apoptosis. No apoptosing germ cells are decorated by CED-1::GFP in the gonad. ced-3 deletion confirmed by genomic triple primer PCR with 5’-AGTTCACCGTGACAGCGTCTCTTC-3’, 5’-CGATTACGACTTGAACTGTATCCGA-3’, and 5’-TCTTGTGTAAACGAGATTTGCAATG-3’. Homozygous ced-3(n2452) yields only 1,110 bp product. Outcrossed heterozygotes yield both 1,411 bp (wild type ced-3) and 1,110 bp products. [NOTE: (11-05-2019) A user has reported this strain exhibits temperature-sensitive sterility when raised at 25C.]
LIU1 C. elegans ldrIs1. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Reference: Zhang P, et al. Mol Cell Proteomics. 2012 Aug;11(8):317-28.
LP162 C. elegans nmy-2(cp13[nmy-2::GFP + LoxP]) I. Show Description
cp13[nmy-2::gfp + LoxP] I. GFP inserted into the endogenous nmy-2 gene by Cas9-triggered homologous recombination. Green fluorescence in many tissues, especially the germline. Fluorescence is similar to, but brighter than, the nmy-2::GFP transgene zuIs45. Reference: Dickinson DJ, et al. 2013 Nature Methods Advance Online Publication. DOI: 10.1038/nmeth.2641.
LP869 C. elegans cpSi171 I. Show Description
cpSi171 [vha-8p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in multiple tissues including intestine, hypodermis, and excretory cell.
LP870 C. elegans cpSi172 I. Show Description
cpSi172 [myo-2p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in the pharynx.
LP871 C. elegans cpSi174 I. Show Description
cpSi174 [myo-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in body wall muscle.
LSC59 C. elegans nlp-37(tm4393) X; lstEx24. Show Description
lstEx24 [pdf-2p::pdf-2::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. lst24 rescues pdf-2; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.
LSD1097 C. elegans smg-1(cc546) I; xchEx97. Show Description
xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
LV18 C. elegans unc-45(wc1) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (dauer escapers will be Par and give only dead eggs), and DpyUcs which arrest as dead eggs (range from twitching multicellulars to 3-folds that hatch). [There is a greater percentage of hatchlings when the mother is heterozygous (wc1 dpy-1/+). There may also be the possibility of near complete maternal rescue (near full-sized, sterile Dpys), but this has not been routinely observed in the balanced strain (as opposed to wc1 dpy-1/+).] Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: The dauers are not giving dead eggs-they are giving other dauers. Appears that the Par mutation is no longer present.]
LV19 C. elegans unc-45(wc2) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (escapers will be Par and give only dead eggs) and DpyUncs which are dead eggs (a range of embryonic lethality from multicellular twitchers to 3-folds that do not hatch). Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: the dauers are giving dead eggs.]
LW709 C. elegans jjIs709 I. Show Description
jjIs709 [(pDRNL1) + lmn-1p::GFP::lmn-1::unc-54 3'utr + (pMH86) dpy-20(+)] I. GFP-tagged LMN-1 is expressed in all somatic cells. Reference: Haithcock E, et al. (2005) PNAS 102:16690-5.
LX2004 C. elegans vsIs183 lite-1(ce314) lin-15B&lin-15A(n765) X. Show Description
vsIs183 [nlp-3p::GCaMP5::nlp-3 3'UTR + nlp-3p::mCherry::nlp-3 3'UTR + lin-15(+)] X. Integrated transgene using nlp-3 promoter to drive GCaMP5 and mCherry expression in HSN; useful for visualizing and quantitating calcium influx in HSN. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
LX677 C. elegans rgs-7(vs98)/unc-1(n496) lon-2(e678) X. Show Description
Heterozygotes are Unc but not Lon. n496 is dominant. Segregates LonUnc. vs98 homozygotes are non-Unc, non-Lon and are Mel (they give only dead eggs). Strain will break down due to recombination so check for the presence of vs98 by PCR every few generations. Received new stock Feb 2005.
MD4195 C. elegans unc-119(ed3) III; bcSi69 IV. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. [NOTE: MD4195 can be maintained at 20C instead of 15C because it does not carry an array with guide RNAs targeting essential genes.] Generated in parental strain EG8081. Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4571 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1367. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1367 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1367 array contains a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4572 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1368. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1368 [U6p::rrn-1(sgRNAs1-4 targeting the rrn-1 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1368 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4574 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1370. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1370 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-1 locus) + U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1370 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I) and a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MDH33 C. elegans otIs339; otIs355. Show Description
otIs339 [ceh-43(+)(fosmid)::GFP + ttx-3::DsRed + rol-6(su1006)]. otIs355 [rab-3::NLS::tagRFP]. Rollers.