More Fields
Strain Species Genotype
BN359 C. elegans ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III); qaIs3502. Show Description
qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Germline expression of YFP::lmn-1. CFP::HIS is silenced in qaIs3502. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strains XA3502 and XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
BN360 C. elegans ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III); qaIs3502; ojIs1. Show Description
ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Germline expression of YFP::lmn-1. CFP::HIS is silenced in qaIs3502. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strains XA3502 and XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
BN464 C. elegans bqSi189 II; mel-28(t1684) unc-32(e189)/qC1 dpy-19(e1259) glp-1(q339) III; ojIs1 Show Description
bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 25C to help prevent silencing of ojIs1. mel-28 heterozygotes are wild-type and segregate wild-type, DpySteriles, and Uncs which give only dead eggs. ojIs1 is likely integrated into LG V. bqSi189 is a single-copy MosSCI insertion into ttTi5605 derived from injection of pBN13. Derived from GE2622; this strain might still carry him-3(e1147) in the background. Reference: Gomez-Saldivar G, et al. PLoS Genet. 2016 Jun 24;12(6):e1006131.
BN646 C. elegans bqSi640 II; bqSi470 IV. Show Description
bqSi640 [dpy-7p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi470 [hsp-16.41p::FLAG::NLS::FLP D5 + unc-119(+)] IV. Expression of red and green histones in hypodermal lineage before and after heat shock, respectively.
BP600 C. elegans aff-1(tm2214) II. Show Description
A 1.2 kb deletion in aff-1 (C44B7.3) which introduce stop codon after alanine 47. AFF-1 is a type I membrane protein necessary and sufficient for specific cell fusion events during embryonic and larval development. Temperature sensitivity was not detected. At 20° the fusion of hyp5 in the embryo does not occur as well as anchor cell (AC) fusion, vulval cells fusion of the A and D rings and the terminal fusion between the seam cells late in L4. 6% L1 rod-like lethal and 0% embryonic lethal. Adults are completely Egl, and partially Unc, Pvl. In addition, only 2% of AC in the mutant worms undergo fusion. These animals give very low brood size (16 progeny per worm) and 3.4% of the worms are sterile. This strain gives very small brood size and hence grows slowly. Originally from Shohei Mitani, Tokyo Women's Medical College, Tokyo, Japan.
BP601 C. elegans aff-1(tm2214)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT with major GFP signal in pharynx. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and few GFP- tm2214 homozygotes animals which give very small brood size and hence can only be slowly propagated (see BP600 for detailed description for homozygote tm2214 phenotypes). Pick WT dim GFP non Dpy animals and check for correct segregation of progeny to maintain.
BU7222 C. elegans pat-3(st564) III; kqEx73. Show Description
kqEx73 [pat-3(sp) + rab-3::RFP + cki-1::GFP]. Pick RFP+ to maintain. kqEx73 carries a form of pat-3 gene with splicing defects; rescues pat-3 null allele. pat-3(sp) is a frameshift mutation in the splice acceptor region (ag to aa) that abolishes conserved interaction domains such as the NPxY motifs and creates a splice variant with an extra 19 amino acids. The pat-3(sp) animals not only produce mutant pat-3, but also express the regular splice form due to utilization of an unusual splice acceptor. Abnormal Distal Tip Cell migration and pat-3 gene splicing (intron 7) defects. Reference: Kihira S, et al. PLoS One. 2012;7(8):e42425.
BW1739 C. elegans +/eT1 III; unc-62(t2012) dpy-11(e224)/eT1 V. Show Description
Heterozygotes are wild-type, and segregate WT heterozygotes, Dpy Mel (unc-62 dpy-11 homozygotes), and dead eggs (eT1 homozygotes). unc-62 dpy-11 homozygotes give only dead embryos (96%) or dead larva (4%).
BW1932 C. elegans ctIs39. Show Description
ctIs39 [hbl-1p::GFP::NLS::hbl-1 3'UTR + rol-6(su1006)]. Rollers. Reporter encodes the first 133 amino acids of HBL-1 followed by GFP with SV40 NLS and 1.4 kb of hbl-1 3' UTR. Reference: Fay DS, et al. Dev Biol. 1999 Jan 15;205(2):240-53.
BW1935 C. elegans unc-119(ed3) III; ctIs43 him-5(e1490) V. Show Description
ctIs43 [dbl-1p::GFP + dbl-1p::GFP::NLS + unc-119(+)].
BW1946 C. elegans ctIs43 unc-42(e270) V. Show Description
Unc. ctIs43 [dbl-1p::GFP + dbl-1p::GFP::NLS + unc-119(+)].
BW2027 C. elegans unc-62(ct344) V; yDp1 (IV;V;f). Show Description
Animals carrying the duplication are wild-type. Animals which have lost yDp1 are Unc and give only dead eggs(57%) or dead larvae(43%).
BW54 C. elegans ct350 II. Show Description
Maintain at 15C. Temperature sensitive embryonic lethal. Sterile at 25C. Congenic strain, N2 and Bergerac BE. This allele should NOT be assumed to define a gene to which someone gave the name zyg-12. This name should not be used unless someone finds a non-complementing Bristol mutation. There is no evidence at present that the ts results from a single gene defect. Has been backcrossed >6 times to Bristol strains and should only contain Bergerac DNA in the unc-85 to dpy-10 region.
CB1062 C. elegans daf-18(e1375) IV; vab-3(e1062) X. Show Description
Dauer defective. Notched head. Unlinked double. M-MATING-NO SUCCESS.
CB1255 C. elegans vab-11(e1255) IV. Show Description
Blebs on tail of adult hermaphrodite. Tail irregular, tail cuticle sometimes separated, tail spike sometimes truncated. Some animals have enlarged excretory canals.
CB1259 C. elegans dpy-19(e1259) III. Show Description
Temperature sensitive Dpy. Reproduction poor at 25C. M-MATING+ AT LOW TEMPERATURE ONLY.
CB1370 C. elegans daf-2(e1370) III. Show Description
Temperature sensitive dauer constitutive. Maintain at 15C. 100% dauers at 25C. 15% dauer formation at 20C. Long-lived. M-MATING+LOW TEMPERATURE ONLY.
CB1372 C. elegans daf-7(e1372) III. Show Description
Temperature sensitive dauer constitutive. Crowds. 100% dauers at 25C. Leaky at 20C. Growth slow. M-MATING+LOW TEMPERATURE ONLY.
CB3440 C. elegans anc-1(e1873) I. Show Description
e1873 allele is the only anc-1 allele in which the molecular lesion has been identified (Starr and Han, 2002) and is considered by the authors to be the reference allele. e1873 does not revert, unlike most other alleles of anc-1. Reference: Hedgecock and Thomson. Cell. 1982 Aug;30(1):321-30. Starr and Han. Science. 2002 Oct 11;298(5592):406-9.
CB3695 C. elegans fem-1(e1965)/unc-5(e53) mor-2(e1125) IV. Show Description
WT heterozygote, fem-1(e1965) maternal. Segregates WT heterozygotes, WT fem-1 homozygotes that give only fertile female progeny, and UncMor. (Probably has lost mor-2 [Edgley, 4/92]. When confirmed, should be given a new strain name.)
CB3816 C. elegans tra-3(e1107) IV; unc-58(e665) sup-21(e1957) dpy-6(e14)/+ X. Show Description
Heterozygotes are Unc (shaker; don't move well) and segregate more Shaker Unc, WT and DpyUnc (short and fairly paralyzed). The WT give only males. e1957 previously called sup-21.
CB3855 C. elegans plg-1(e2001) III; him-5(e1490) V. Show Description
Hermaphrodites and males superficially WT. Males lay down a gelatinous plug over the vulva of mated hermaphrodites. Plug formation controlled only by male genotype. Both plg-1 and plg-1/+ males make plugs.
CB3988 C. elegans tra-3(e1107) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Hets are Unc and segregate Unc, WT hermaphrodites and dead eggs. The WT hermaphrodites segregate only abnormal sterile males or intersexes. Maintain by picking Unc.
CB4689 C. elegans dpy-28(y1) III; him-8(e1489) IV. Show Description
y1 is a temperature sensitive mutation affecting only XX animals. him-8(e1489) causes X non-disjunction, resulting in many males. Grow at 15C. XX and XXX animals not viable above 15C. After shifting to 25C, surviving population is almost all XO males.
CB5190 C. elegans tra-2(e2020) II; tra-1(e1099)/+ III; xol-1(y9) X. Show Description
Heterozygous. Maintain by picking fertile hermaphrodites. Stable XX male/female strain (fertile XX females and low fertility XX males); males sire only female progeny. Reference: Strain 3 in Hodgkin (2002) PMID: 12399387.
CB5300 C. elegans fem-1(hc17) IV; xol-1(y9) X. Show Description
WT hermaphrodite if grown at 15-20C. WT females if grown at 25C. When crossed, these females yield only XX viable hermaphrodite progeny, all XO progeny are dead.
CB5600 C. elegans ccIs4251 I; him-8(e1489) IV. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Superficially WT hermaphrodites and males expressing GFP in nuclei and mitochondria of body wall muscles. Fluorescent body wall muscle nuclei can be seen by dissecting microscope with epifluoresence optics. Males mate poorly (ME 1/2). ccIs4251 mapped to LGI, + 2.5.
CB6253 C. elegans bus-8(e2992) X; eEx541. Show Description
eEx541 [bus-8(+) + sur-5p::GFP]. Pick GFP+ to maintain. bus-8(e2892) animals are viable on Leucobacter Verde1, unlike most other bus-8 mutants. References: Partridge et al. (2008) PMID: 18395708. Stroud et al (in preparation).
CB6503 C. elegans bgIs312 I; him-8(e1489) IV; bus-17(e2923) X. Show Description
bgIs312 [pes-6::GFP]. GFP expression in excretory cell only. Bus (resistant to infection by M. nematophilum and Leucobacter Verde2), hypersensitive to Leucobacter Verde1, bleach-sensitive, drug-sensitive; Him (high incidence of males). e2923 is a Mos1 insertion in bus-17 (ZK678.8). Reference: Yook & Hodgkin (2007), Genetics 175: 681-697
CB7272 C. elegans ccIs4251 I; mIs12 II; dpy-17(e164) III; frIs7 IV; uIs69 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. uIs69 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1] V. Mapping strain. This strain is homozygous for integrated fluorescence markers on LG I, II, IV and V, all of which are easily and independently scored using a fluorescent dissecting microscope, plus an easily scored visible marker (dpy-17) for LGIII. The good markers on all five autosomes facilitate linkage assignment of unmapped mutations, and enable rapid replacement of chromosomes when outcrossing heavily mutagenized strains such as those from the Million Mutation Project.
CE1494 C. elegans +/hT2 [dpy-18(h662)] I; pen-2(ep220)/hT2 [bli-4(e937)] III. Show Description
Heterozgyotes are WT and segregate WT, Dpys, and Ste or Mel. Pick wild-type individuals and check for correct segregation of progeny to maintain. bli-4 is suppressed by dpy-1 in hT2 homozygotes-only see a very few DpyBli.This strain cannot be distributed to commercial organizations. ep220 is likely Mel. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CF1514 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx211. Show Description
muEx211[pNL213(ges-1p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.
CF1515 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx212. Show Description
muEx212[pNL212(myo-3p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.
CF1595 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx227. Show Description
muEx227 [(pNL213) ges-1p::GFP::daf-16) + rol-6(su1006)]. Pick Rollers to maintain.
CF1700 C. elegans daf-16(mu86) I; mes-1(bn7) X; muEx248. Show Description
muEx248 [(pNL209) daf-16::GFP::daf-16(cDNA) + podr-1::RFP]. Pick green (body) / red (head neurons) animals. Transmission efficiency ~50%. Can be grown at 20C with some sterility (30-50%). The higher the temperture, the greater the sterility.
CF2018 C. elegans muEx304. Show Description
muEx304 [lys-7p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2037 C. elegans muEx311. Show Description
muEx311 [pep-2p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2038 C. elegans muEx312. Show Description
muEx312 [dod-17p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2124 C. elegans muIs139. Show Description
muIs139 [dod-11p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2962 C. elegans muEx420. Show Description
muEx420 [hsp-12.6p::RFP(NLS) + odr-1p::RFP]. Pick RFP+ animals to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CGC12 C. elegans umnIs2 V. Show Description
umnIs2 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] V. Derived by insertion of tdTomato transgene into parental strain N2 using CRISPR/Cas9.
CGC128 C. elegans +/hT2 [umnIs15] I; dcr-1(pk1351)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, dcr-1 homozygotes (protruding vulva, sterile/egl, rupture at vulva), lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Pvul. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived from parental strains CGC26 and NL687. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC13 C. elegans unc-5(e53)/nT1 [umnIs3] IV; dpy-11(e224)/nT1 V. Show Description
umnIs3 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] IV. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT with tdTomato expression. Derived by insertion of tdTomato transgene into parental strain MT1000 using CRISPR/Cas9.
CGC135 C. elegans let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
CGC136 C. elegans mir-84(umn46[mir-84p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) X. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.
CGC137 C. elegans mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
CGC15 C. elegans umnIs4 III. Show Description
umnIs4 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] III. Derived by insertion of tdTomato transgene into parental strain N2 using CRISPR/Cas9.
CGC152 C. elegans mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC153 C. elegans mir-48(umn60[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::linker::mODC(422-461)(E428A/E430A/E431A):: lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC159 C. elegans mir-61&mir-250(umn66[mir-61p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722]) II. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed, leaving the SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3'UTR transcriptional reporter in the locus