More Fields
Strain Species Genotype
GR1168 C. elegans age-1(mg44)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
age-1(mg44) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive); can be rescued zygotically. age-1(mg44) homozygous animals that are maternally rescued for dauer formation are long-lived. mg44 is a Trp405 Amber mutation. Heterozygotes are WT and segregate WT (1/3 of which throw only dauers) and DpyUncs.
GS3582 C. elegans unc-4(e120) II; arIs92. Show Description
arIs92[egl-17p::NLS-CFP-LacZ + unc-4(+) + ttx-3::GFP]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS3798 C. elegans arIs99. Show Description
arIs99 [dpy-7p::2Xnls::YFP]. Reference: Myers TR & Greenwald I, Dev Cell. 2005 Jan;8(1):117-23. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS4815 C. elegans arIs98. Show Description
arIs98 [apx-1p::2xNLS::YFP + ceh-22p::GFP + dpy-20(+)]. References: Li J, Greenwald I. Curr Biol. 2010 Oct 26;20(20):1875-9. Karp X, Greenwald I. Proc Natl Acad Sci USA. 2013 Feb 5;110(6):2181-6. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS4892 C. elegans arIs131 III. Show Description
arIs131 [lag-2p::2xNLS::YFP + ceh-22p::GFP + pha-1(+)] III. References: Li J, Greenwald I. Curr Biol. 2010 Oct 26;20(20):1875-9. Zhang X, Greenwald I. Genetics. 2011 Aug;188(4):847-58. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS5231 C. elegans arIs116 X. Show Description
arIs116 [lst-5p::2xNLS::YFP + ttx-3p::GFP + pha-1(+)] X. References: Li J, Greenwald I. Curr Biol. 2010 Oct 26;20(20):1875-9. Karp X, Greenwald I. Proc Natl Acad Sci USA. 2013 Feb 5;110(6):2181-6. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS6107 C. elegans arIs107. Show Description
arIs107 [mir-61p::2xNLS::YFP + ttx-3p::GFP + pha-1(+)]. References: Yoo AS, Greenwald I. Science. 2005 Nov 25;310(5752):1330-3. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GT330 C. elegans aSi8 II; unc-119(ed3) III. Show Description
aSi8 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT332 C. elegans aSi10 II; unc-119(ed3) III. Show Description
aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3’UTR::Split 3’ HygR::tjp2a_guide::Split 3’ mScarlet-I::egl-13nls::tbb-2 3’UTR]?II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
GT347 C. elegans aSi23 II; unc-119(ed3) III. Show Description
aSi23 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT350 C. elegans aSi26 II; unc-119(ed3) III. Show Description
aSi26 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GT372 C. elegans aSi31 II; unc-119(ed3) III Show Description
aSi31 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
GW1119 C. elegans lsm-8 (xe17[myo-2p::mCherry::unc-54 3'UTR]) IV/nT1 [qIs51] (IV;V); pkIs1582 V/nT1 [qIs51] (IV;V). Show Description
pkIs1582 [let-858::GFP + rol-6(su1006)] V. Homozygous lethal lsm-8 deletion balanced by GFP-marked nT1 translocation. xe17 generated by CRISPR/Cas9-engineered replacement of the gene with a red pharyngeal marker. lsm-8 heterozygotes are wild-type (will roll in this case because of pkIs1582) green & red pharynx, and will segregate rolling heterozygotes (green & red pharynx), arrested nT1[qIs51] aneuploids (only green pharynx), and lsm-8 homozygotes (only red pharynx). Homozygous nT1[qIs51] inviable. Pick rollers with green & red pharynx and check for correct segregation of progeny to maintain. Reference: Mattout A, et al. Nat Cell Biol. 2020 May;22(5):579-590. PMID: 32251399
HA300 C. elegans lin-15B&lin-15A(n765) X; rtEx223. Show Description
rtEx223 [nlp-6p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.
HA328 C. elegans lin-15B&lin-15A(n765) X; rtEx233. Show Description
rtEx233 [nlp-11p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA329 C. elegans lin-15B&lin-15A(n765) X; rtEx234. Show Description
rtEx234 [nlp-13p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv or GFP+ to maintain array.
HA341 C. elegans lin-15B&lin-15A(n765) X; rtEx235. Show Description
rtEx235 [nlp-3p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.
HA353 C. elegans lin-15B&lin-15A(n765) X; rtEx247. Show Description
rtEx247 [nlp-14p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA357 C. elegans lin-15B&lin-15A(n765) X; rtEx251. Show Description
rtEx251 [nlp-15p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA367 C. elegans lin-15B&lin-15A(n765) X; rtEx256. Show Description
rtEx256 [nlp-18p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA371 C. elegans lin-15B&lin-15A(n765) X; rtEx260. Show Description
rtEx260 [nlp-19p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA444 C. elegans lin-15B&lin-15A(n765) X; rtEx330. Show Description
rtEx330 [nlp-21p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA446 C. elegans lin-15B&lin-15A(n765) X; rtEx332. Show Description
rtEx332 [nlp-20p::GFP + lin-15(+)]. Pick non-Muv or GFP+ to maintain.
HA449 C. elegans lin-15B&lin-15A(n765) X; rtEx335. Show Description
rtEx335 [nlp-10p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.
HA450 C. elegans lin-15B&lin-15A(n765) X; rtEx336. Show Description
rtEx336 [nlp-12p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA759 C. elegans pqe-1(rt13) III; rtIs11 V. Show Description
rtIs11 [osm-10p::GFP + osm-10p::HtnQ150 + dpy-20(+)]. osm-10 promoter drives expression of both GFP and Htn-Q150 strongly in ASH and more weakly in other neurons of the head and tail. pqe-1(rt13) accelerates Htn-Q150 induced toxicity resulting in ASH neuron cell death predominantly during larval stages. Hence, many adult animals will lack overt GFP expression in ASH neurons. rtEx377 in the original HA759 was selected against leaving only rtIs11 in the strain available at the CGC.
HA98 C. elegans lin-15B&lin-15A(n765) X; rtEx66. Show Description
rtEx66 [nlp-2p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.
HBR1549 C. elegans goeIs326. Show Description
goeIs326 [hsp-16.2p::nlp-29::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-29::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1899 C elegans goeIs406. Show Description
goeIs406 [hsp-16.2p::nlp-31::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-31::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1900 C. elegans goeIs408. Show Description
goeIs408 [hsp-16.2p::nlp-27::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-27::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1902 C. elegans goeIs409. Show Description
goeIs409 [hsp-16.2p::nlp-32::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-32::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1961 C. elegans goeIs431. Show Description
goeIs431 [hsp-16.2p::nlp-25::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-25::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1971 C. elegans nlp-42(syb235) V. Show Description
Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type. Primers for crossing: Fwd: cgagacttttaaccccgtcg InFwd: aaagcccatgacttgctgaa Rev: gctcaggtggttagagggtt Wild-type bands: 580bp, 2652bp. Mutation band: 335bp.
HBR2025 C. elegans unc-119(ed3) III; goeEx711. Show Description
goeEx711 [nlp-42p::mGFP::unc-54 3'UTR + unc-119(+)]. Pick non-Unc to maintain. Construct contains 2000 bp of nlp-42 promoter upstream of start. Expression pattern is variable between worms.
HBR2317 C. elegans nlp-8(syb762) IV. Show Description
syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HC114 C. elegans ccIs4251 I; qtIs3 III; mIs11 IV; sid-1(qt9) V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding and injection and endogenous hairpin expression.
HC271 C. elegans ccIs4251 I; qtIs3 sid-2(qt42) III; mIs11 IV. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding only.
HC75 C. elegans ccIs4251 I; sid-1(qt2) V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Resistant to systemic RNAi, but sensitive to autonomous RNAi.
HCC27 C. elegans hwSi8 II; unc-119(ed9) III. Show Description
hwSi8 [pie-1p::GFP::mex-3(601-1248)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing a portion of MEX-3(601-1248) required for protein degradation. At about the 12-cell stage, soma-germline asymmetry is briefly visible before GFP::MEX-3(601-1248) becomes undetectable even in the germline blastomeres. Detected weakly on P granules only in the presence of endogenous MEX. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.
HMZ245 C. elegans ccar-1(sda11) IV. Show Description
Superficially wild-type except for a slightly shorter body length in adults. Crispr/Cas9 was used to create a 13 bp deletion in exon7 of ccar-1a; breakpoints: CTGATTCGGGAG/sda11/ATCGGAAGTTTC. sda11 is an isoform-specific deletion allele. It only affects the function of CCAR-1A and CCAR-1D, but not CCAR-1B and C. In addition, because CCAR-1D is not expressed in embryos,this allele can be used to specifically inactivate CCAR-1A (the full-length isoform that is the most similar to human CCAR1) during embryogenesis. Reference: Fu R, et al. J Cell Sci. 2018 May 10.
HR16 C. elegans mel-23(ct45)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT and DpySteriles. ct45 homozygotes give only dead eggs at all temperatures. ct45 is ts dominant. Hets give more viable progeny at 15C than 25C.
HR961 C. elegans ced-7(n1829) dpy-17(e164) III. Show Description
Dpy. Maternal effect persistent cell corpses. This was derived from MT4993; it was outcrossed once to get rid of an unlinked lethal. Hatching rate has improved from 10-70% to 98%.
HS1680 C. elegans lin-44(n1792) zdIs5 I; cwn-1(ok546) II; egl-20(n585) cwn-2(ok895) IV/nT1 [qIs51] (IV;V); mom-2(ne874) V/nT1. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. Homozygous nT1[qIs51] are inviable. mec-4::GFP is expressed in touch neurons. Heterozygotes are strong Egl Psa GFP+ and segregate dead eggs and non-GFP Unc Egl Psa that give only dead eggs at 25C.
HS661 C. elegans nob-1(os68) III. Show Description
Healthy. Abnormal morphology of the tail (only at Nomarski level). Defects in asymmetric T cell division causes Psa (phasmid socket absent).
HW1835 C. elegans lin-29(xe40 xe65[lin-29b::gfp::3xflag]) II. Show Description
Partially penetrant Pvl and Egl. xe40 specifically disrupts the LIN-29A isoform. The GFP tag was inserted at the shared C-terminus of LIN-29A/B in the xe40 background, so only the labeled B isoform is expressed. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Pereira et al., (2019) Timing mechanism of sexually dimorphic nervous system differentiation. eLIFE 8: e42078. https://doi.org/10.7554/eLife.42078
HY463 C. elegans unc-32(e189) pod-1(ye11)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs. Unc worms produce only dead embyros due to strict maternal effect pod-1(ye11) mutation. Embryos from pod-1 homozygous hermaphrodites are osmotically sensitive and exhibit polarity defects.
IG1107 C. elegans sta-2(fr67) V; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG1110 C. elegans snf-12(fr70) X; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG1114 C. elegans snf-12(fr74) X; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG1352 C. elegans nipi-4(fr71) V; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.