Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. t1440 previously called mel-27.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles and Uncs which give only dead eggs. This strain was mistakenly called emb-30 in the paper; it is not an emb-30 allele.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. tbg-1(t1465) previously called sas-3(t1465).

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

sup-37 suppresses temperature sensitive embryonic lethality of e2123. Strain is viable at 15C and 25C. Dpy. Behavioural mutation leading to avoidance of bacteria (worms tend to concentrate just outside the lawn) unlinked to sup-37.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

zcIs13 [hsp-6p::GFP + lin-15(+)] V. Stable transgenic line with GFP expression mainly in the posterior intestine, observed from L1 to adult. Perturbation of mitochondrial folding environment induces robust GFP expression throughout the intestines. Derived by outcrossing parental strain SJ4100 to N2 six times to remove suspected background mutations causing uneven transgene expression and low penetrance of sterility.

Heterozygotes are WT and segregate WT and DpyUnc. age-1(mg44) homozygotes from heterozygous mothers are WT and segregate only dauers at all temperatures. mg44 pka daf-23(mg44).

age-1(mg44) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive); can be rescued zygotically. age-1(mg44) homozygous animals that are maternally rescued for dauer formation are long-lived. mg44 is a Trp405 Amber mutation. Heterozygotes are WT and segregate WT (1/3 of which throw only dauers) and DpyUncs.

arIs92[egl-17p::NLS-CFP-LacZ + unc-4(+) + ttx-3::GFP]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

arIs99 [dpy-7p::2Xnls::YFP]. Reference: Myers TR & Greenwald I, Dev Cell. 2005 Jan;8(1):117-23. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

arIs98 [apx-1p::2xNLS::YFP + ceh-22p::GFP + dpy-20(+)]. References: Li J, Greenwald I. Curr Biol. 2010 Oct 26;20(20):1875-9. Karp X, Greenwald I. Proc Natl Acad Sci USA. 2013 Feb 5;110(6):2181-6. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

arIs131 [lag-2p::2xNLS::YFP + ceh-22p::GFP + pha-1(+)] III. References: Li J, Greenwald I. Curr Biol. 2010 Oct 26;20(20):1875-9. Zhang X, Greenwald I. Genetics. 2011 Aug;188(4):847-58. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

arIs116 [lst-5p::2xNLS::YFP + ttx-3p::GFP + pha-1(+)] X. References: Li J, Greenwald I. Curr Biol. 2010 Oct 26;20(20):1875-9. Karp X, Greenwald I. Proc Natl Acad Sci USA. 2013 Feb 5;110(6):2181-6. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

arIs107 [mir-61p::2xNLS::YFP + ttx-3p::GFP + pha-1(+)]. References: Yoo AS, Greenwald I. Science. 2005 Nov 25;310(5752):1330-3. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

aSi8 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3’UTR::Split 3’ HygR::tjp2a_guide::Split 3’ mScarlet-I::egl-13nls::tbb-2 3’UTR]?II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

aSi23 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

aSi26 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

aSi31 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

pkIs1582 [let-858::GFP + rol-6(su1006)] V. Homozygous lethal lsm-8 deletion balanced by GFP-marked nT1 translocation. xe17 generated by CRISPR/Cas9-engineered replacement of the gene with a red pharyngeal marker. lsm-8 heterozygotes are wild-type (will roll in this case because of pkIs1582) green & red pharynx, and will segregate rolling heterozygotes (green & red pharynx), arrested nT1[qIs51] aneuploids (only green pharynx), and lsm-8 homozygotes (only red pharynx). Homozygous nT1[qIs51] inviable. Pick rollers with green & red pharynx and check for correct segregation of progeny to maintain. Reference: Mattout A, et al. Nat Cell Biol. 2020 May;22(5):579-590. PMID: 32251399

rtEx223 [nlp-6p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.

rtEx233 [nlp-11p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.

rtEx234 [nlp-13p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv or GFP+ to maintain array.

rtEx235 [nlp-3p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.

rtEx247 [nlp-14p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.

rtEx251 [nlp-15p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.

rtEx256 [nlp-18p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.

rtEx260 [nlp-19p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.

rtEx330 [nlp-21p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.

rtEx332 [nlp-20p::GFP + lin-15(+)]. Pick non-Muv or GFP+ to maintain.

rtEx335 [nlp-10p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.

rtEx336 [nlp-12p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.

rtIs11 [osm-10p::GFP + osm-10p::HtnQ150 + dpy-20(+)]. osm-10 promoter drives expression of both GFP and Htn-Q150 strongly in ASH and more weakly in other neurons of the head and tail. pqe-1(rt13) accelerates Htn-Q150 induced toxicity resulting in ASH neuron cell death predominantly during larval stages. Hence, many adult animals will lack overt GFP expression in ASH neurons. rtEx377 in the original HA759 was selected against leaving only rtIs11 in the strain available at the CGC.

rtEx66 [nlp-2p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.

goeIs326 [hsp-16.2p::nlp-29::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-29::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs406 [hsp-16.2p::nlp-31::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-31::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs408 [hsp-16.2p::nlp-27::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-27::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs409 [hsp-16.2p::nlp-32::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-32::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs431 [hsp-16.2p::nlp-25::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-25::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type. Primers for crossing: Fwd: cgagacttttaaccccgtcg InFwd: aaagcccatgacttgctgaa Rev: gctcaggtggttagagggtt Wild-type bands: 580bp, 2652bp. Mutation band: 335bp.

goeEx711 [nlp-42p::mGFP::unc-54 3'UTR + unc-119(+)]. Pick non-Unc to maintain. Construct contains 2000 bp of nlp-42 promoter upstream of start. Expression pattern is variable between worms.

syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding and injection and endogenous hairpin expression.