More Fields
Strain Species Genotype
HA449 C. elegans lin-15B&lin-15A(n765) X; rtEx335. Show Description
rtEx335 [nlp-10p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.
HA450 C. elegans lin-15B&lin-15A(n765) X; rtEx336. Show Description
rtEx336 [nlp-12p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.
HA759 C. elegans pqe-1(rt13) III; rtIs11 V. Show Description
rtIs11 [osm-10p::GFP + osm-10p::HtnQ150 + dpy-20(+)]. osm-10 promoter drives expression of both GFP and Htn-Q150 strongly in ASH and more weakly in other neurons of the head and tail. pqe-1(rt13) accelerates Htn-Q150 induced toxicity resulting in ASH neuron cell death predominantly during larval stages. Hence, many adult animals will lack overt GFP expression in ASH neurons. rtEx377 in the original HA759 was selected against leaving only rtIs11 in the strain available at the CGC.
HA98 C. elegans lin-15B&lin-15A(n765) X; rtEx66. Show Description
rtEx66 [nlp-2p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.
HBR1549 C. elegans goeIs326. Show Description
goeIs326 [hsp-16.2p::nlp-29::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-29::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1899 C elegans goeIs406. Show Description
goeIs406 [hsp-16.2p::nlp-31::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-31::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1900 C. elegans goeIs408. Show Description
goeIs408 [hsp-16.2p::nlp-27::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-27::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1902 C. elegans goeIs409. Show Description
goeIs409 [hsp-16.2p::nlp-32::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-32::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1961 C. elegans goeIs431. Show Description
goeIs431 [hsp-16.2p::nlp-25::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-25::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1971 C. elegans nlp-42(syb235) V. Show Description
Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type. Primers for crossing: Fwd: cgagacttttaaccccgtcg InFwd: aaagcccatgacttgctgaa Rev: gctcaggtggttagagggtt Wild-type bands: 580bp, 2652bp. Mutation band: 335bp.
HBR2025 C. elegans unc-119(ed3) III; goeEx711. Show Description
goeEx711 [nlp-42p::mGFP::unc-54 3'UTR + unc-119(+)]. Pick non-Unc to maintain. Construct contains 2000 bp of nlp-42 promoter upstream of start. Expression pattern is variable between worms.
HBR2317 C. elegans nlp-8(syb762) IV. Show Description
syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HC114 C. elegans ccIs4251 I; qtIs3 III; mIs11 IV; sid-1(qt9) V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding and injection and endogenous hairpin expression.
HC271 C. elegans ccIs4251 I; qtIs3 sid-2(qt42) III; mIs11 IV. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding only.
HC75 C. elegans ccIs4251 I; sid-1(qt2) V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Resistant to systemic RNAi, but sensitive to autonomous RNAi.
HCC27 C. elegans hwSi8 II; unc-119(ed9) III. Show Description
hwSi8 [pie-1p::GFP::mex-3(601-1248)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing a portion of MEX-3(601-1248) required for protein degradation. At about the 12-cell stage, soma-germline asymmetry is briefly visible before GFP::MEX-3(601-1248) becomes undetectable even in the germline blastomeres. Detected weakly on P granules only in the presence of endogenous MEX. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.
HMZ245 C. elegans ccar-1(sda11) IV. Show Description
Superficially wild-type except for a slightly shorter body length in adults. Crispr/Cas9 was used to create a 13 bp deletion in exon7 of ccar-1a; breakpoints: CTGATTCGGGAG/sda11/ATCGGAAGTTTC. sda11 is an isoform-specific deletion allele. It only affects the function of CCAR-1A and CCAR-1D, but not CCAR-1B and C. In addition, because CCAR-1D is not expressed in embryos,this allele can be used to specifically inactivate CCAR-1A (the full-length isoform that is the most similar to human CCAR1) during embryogenesis. Reference: Fu R, et al. J Cell Sci. 2018 May 10.
HR16 C. elegans mel-23(ct45)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT and DpySteriles. ct45 homozygotes give only dead eggs at all temperatures. ct45 is ts dominant. Hets give more viable progeny at 15C than 25C.
HR961 C. elegans ced-7(n1829) dpy-17(e164) III. Show Description
Dpy. Maternal effect persistent cell corpses. This was derived from MT4993; it was outcrossed once to get rid of an unlinked lethal. Hatching rate has improved from 10-70% to 98%.
HS1680 C. elegans lin-44(n1792) zdIs5 I; cwn-1(ok546) II; egl-20(n585) cwn-2(ok895) IV/nT1 [qIs51] (IV;V); mom-2(ne874) V/nT1. Show Description
zdIs5 [mec-4::GFP + lin-15(+)]. Homozygous nT1[qIs51] are inviable. mec-4::GFP is expressed in touch neurons. Heterozygotes are strong Egl Psa GFP+ and segregate dead eggs and non-GFP Unc Egl Psa that give only dead eggs at 25C.
HS661 C. elegans nob-1(os68) III. Show Description
Healthy. Abnormal morphology of the tail (only at Nomarski level). Defects in asymmetric T cell division causes Psa (phasmid socket absent).
HW1835 C. elegans lin-29(xe40 xe65[lin-29b::gfp::3xflag]) II. Show Description
Partially penetrant Pvl and Egl. xe40 specifically disrupts the LIN-29A isoform. The GFP tag was inserted at the shared C-terminus of LIN-29A/B in the xe40 background, so only the labeled B isoform is expressed. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Pereira et al., (2019) Timing mechanism of sexually dimorphic nervous system differentiation. eLIFE 8: e42078. https://doi.org/10.7554/eLife.42078
HY463 C. elegans unc-32(e189) pod-1(ye11)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs. Unc worms produce only dead embyros due to strict maternal effect pod-1(ye11) mutation. Embryos from pod-1 homozygous hermaphrodites are osmotically sensitive and exhibit polarity defects.
IG1107 C. elegans sta-2(fr67) V; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG1110 C. elegans snf-12(fr70) X; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG1114 C. elegans snf-12(fr74) X; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG1352 C. elegans nipi-4(fr71) V; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG1839 C. elegans frSi17 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454
IG1846 C. elegans frSi21 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454
IG274 C. elegans frIs7. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. The nlp-29p::GFP reporter is induced in the epidermis upon infection with Drechmeria coniospora, wounding and osmotic stress. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9.
IG339 C. elegans tpa-1(fr1) frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.
IG341 C. elegans tpa-1(fr3) frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.
IG342 C. elegans frIs7 IV; nipi-3(fr4) X. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Slo, Sma, and Dpy at 25C. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9.
IG348 C. elegans fasn-1(fr8) I; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Constitutive expression of antimicrobial peptide nlp-29. Maintain under normal conditions. Reference: Lee KZ, et al. Virulence. 2010 May-Jun;1(3):113-22.
IG692 C. elegans tir-1(tm3036) III; frIs7. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Reference: Pujol N, et al. PLoS Pathog. 2008 Jul 18;4(7):e1000105.
JCP152 C. elegans dpy-11(e224) ccz-1(t2129) V; jcpEx2. Show Description
jcpEx2 [ced-1p::F58G11.6(genomic)::YFP::let-858 3'UTR + unc-119(+) + myo-2::GFP]. Maintain by picking GFP+. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
JCP169 C. elegans dpy-11(e224) ccz-1(t2129) V; jcpEx3. Show Description
jcpEx3 [ccz-1p::ccz-1(genomic)::YFP::let-858 3'UTR + unc-119(+) + pha-1(+)]. Array rescues lethality. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
JCP53 C. elegans dpy-11(e224) ccz-1(t2129) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ccz-1 homozygotes (produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
JDW10 C. elegans wrdSi3 II. Show Description
wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
JDW220 C. elegans wrdSi18 I. Show Description
wrdSi18 [^SEC^mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
JDW221 C. elegans wrdSi50 I. Show Description
wrdSi50 [mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
JDW222 C. elegans wrdSi8 II. Show Description
wrdSi8 [^SEC^mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
JDW223 C. elegans wrdSi51 II. Show Description
wrdSi51 [mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
JDW224 C. elegans wrdSi22 I. Show Description
wrdSi22 [^SEC^eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). SEC spotaneously excises at a high frequency so non-rollers will appear. Pick Rollers to maintain. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
JDW225 C. elegans wrdSi23 I. Show Description
wrdSi23 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
JDW227 C. elegans wrdSi45 II. Show Description
wrdSi45 [dpy-7p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
JDW229 C. elegans wrdSi47 I. Show Description
wrdSi47 [dpy-7p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
JDW231 C. elegans wrdSi44 II. Show Description
wrdSi44 [SCMp*::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Seam cell-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in seam cell nuclei. Some expression in hypodermal cells. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
JDW233 C. elegans wrdSi46 I. Show Description
wrdSi46 [SCMp*::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Seam cell-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in seam cell nuclei. Some expression in hypodermal cells. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
JDW313 C. elegans jsSi1579; wrdSi58 II. Show Description
wrdSi58 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140