More Fields
Strain Species Genotype
ZG611 C. elegans iaIs19. Show Description
iaIs19 [gcy-32p::GFP + unc-119(+)]. Expression of gcy-32::GFP is consistenly observed in AQR, PQR, and URX neurons.
ZM10767 C. elegans hpIs819. Show Description
hpIs819 [twk-40p(short)::GCaMP::T2A::NLS::mNeptune + lin-15(+)]. Cytoplasmic GFP and nuclear RFP in AVA, AVE, AVB and some neurons in RVG, and tail (DVA).
ZM11034 C. elegans hpIs819; hpIs810. Show Description
hpIs819 [twk-40p(short)::GCaMP::T2A::NLS::mNeptune + lin-15(+)]. hpIs810 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Transgenic animals exhibit strong RFP signals in AVA soma and neurites; cytoplasmic GFP and RFP in AVA, AVE, AVB and some neurons in RVG and tail (DVA).
ZM5101 C. elegans hpIs193. Show Description
hpIs193 [nlf-1p::nlf-1::GFP + lin-15(+)]. GFP expression in head and tail neurons, as well as along ventral cord. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043
ZM6610 C. elegans nlf-1(hp428) X. Show Description
Fainter. hp428 is a G to A substitution that alters the 3? splice junction of the first intron resulting in a single base pair deletion in the hp428 cDNA causing a frame-shift and premature stop. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. doi: 10.1016/j.neuron.2013.01.018. PMID: 23522043.
ZM8607 C. elegans hpIs481. Show Description
hpIs481 [ceh-12p::tomm20::miniSOG::SL2::BFP + unc-129(DB)p::tomm20::miniSOG::SL2::BFP + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. unc-129(DB)p is a fragment of the unc-129 promoter driving expression in only DB motor neurons (described in Colavita et al., Science 1998 31;281(5377):706-9). The ceh-12 promoter drives expression in VB motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9062 C. elegans hpIs583. Show Description
hpIs583 [acr-2(s)p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of A- and B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. acr-2s(p) is a 1.8 kb fragment of the acr-2 promoter driving expression in only A- and B- class motor neurons (described in Jospin et al, 2009 PLoS Biol. Dec;7(12):e1000265). Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9624 C. elegans lin-15(n765) X; hpIs675. Show Description
hpIs675 [rgef-1p::GCaMP6s::3xNLS::mNeptune + lin-15(+)]. Worms express GCaMP6s and mNeptune in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446
ZR2 C. elegans jmjd-3.1(gk384) X. Show Description
Gonadal enlargement and aberrant gonad migration. Phenotype evident at 25C.
ZT73 C. elegans coh-4(tm1857) coh-3(gk112)/tmC16 [unc-60(tmIs1210)] coh-3(gk112) V. Show Description
Pick wild-type Venus+ animals to maintain. coh-4(tm1857) coh-3(gk112) homozygotes exhibit defects in synaptonemal complex formation on meiotic chromosomes. Many of the progeny from coh-4 coh-3 homozygotes exhibit embryonic lethality, likely due to aneuploidy, but only a few progeny hatch and exhibit the Him phenotype. The coh-3 and coh-4 genes encode nearly identical meiosis-specific kleisins. The deletion mutations can be checked by PCR with the following primers: coh-4(tm1857): TACGCGGCACACATGGGTCT and CAATTCCCCCTAGACATACGATTC; coh-3(gk112): CTCGCAGCGATCGAGCAAGC and AACTGAACATGAGAGCCACGAAG. tmC16 homozygotes are Unc Venus(+). [NOTE: ZT73 with the inversion-based balancer is more amenable to producing coh-4 coh-3 homozygous mutant males than TY5120 with a translocation-based balancer.] Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.