mdEx865 [unc-17p::NLS::mCherry + pha-1(+)]. Transcriptional reporter. Nuclear localized mCherry in cholinergic neurons. Maintain at 20-25C to retain array. References: Grundahl K and Rand J, unpublished. Granato M, Schnabel H, and Schnabel R, 1994. Genesis of an organ: molecular analysis of the pha-1 gene. Development 120: 3005–3017.

md1447 is a spontaneous 465-bp deletion (with a 2-bp insertion) within the unc-17 3'UTR in a TR638 background. Protein level by immunostaining is barely detectible , but unc-17 behavioral phenotypes are relatively mild. Sequence details (in direction of transcription): TCGTAGATTTGGATCTCTGAATATG/Ä465+AA/AGTGATTTCGTATAGAGTAATGTCA . This allele is the only smg-suppressible allele of unc-17 reported thus far. Since the md1447 deletion is entirely within the unc-17 3'UTR, the amino acid sequence of the UNC-17 protein is completely wild-type. Therefore the phenotype derives from the nonsense-mediated decay of the transcript which in turn leads to an extremely low level of wild-type UNC-17 protein (see figure on following page). Many other unc-17 alleles have reduced immunoreactivity (but more immunoreactivity than md1447) yet significantly stronger behavioral phenotypes than md1447. Therefore, the behavioral phenotypes of these other alleles are not due to reduced transporter. Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.

mGreenLantern tag inserted at the C-terminus of the endogenous idpc-1/Y47D3B.6 locus. mGreenLantern expression in the pharyngeal cuticle. Reference: Kamal M, et al. "A Spatiotemporal Reconstruction of the C. elegans Pharyngeal Cuticle Reveals a Structure Rich in Phase-Separating Proteins." https://www.biorxiv.org/content/10.1101/2022.03.11.483951v1

rab-3(ftw79[rab-3::SL2::LoxP::GFP::NLS::3'UTR::Abeta(inv)::sigPep(inv)::T2A(inv)::wrmScarlet11(inv)::LoxP(inv)]) II. Modified endogenous rab-3 locus co-expresses stochastic, switchable cassette by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. Inverted LoxP sites flank the GFP-NLS and inverted wrmScarlet11::T2A::signalPeptide::Abeta insert. Please contact Ryan Littlefield prior to publishing work using this strain.

unc-54(ftw19[NLS::mCherry::SL2::GFP::unc-54]) I. myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. Endogenous unc-54 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Endogenous myo-3 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous tni-3 locus tagged with mCherry using CRISPR/Cas9. GFP-nls coexpressed from the endogenous promoter using SL2 trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. mCherry tag inserted into endogenous tni-3 locus; GFP::NLS coexpressed from the endogenous tni-3 promoter via SL2 trans-splicing. GFP::UNC-94 is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. GFP::UNC-94 is not visible on fluorescent dissection microscopes. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous myo-3 locus tagged with mCherry using CRISPR/Cas9. nls-GFP coexpressed from the endogenous promoter using trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. mCherry tag inserted into endogenous myo-3 locus; GFP::NLS coexpressed from the endogenous myo-3 promoter via SL2 trans-splicing. GFP::UNC-94 is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. GFP::UNC-94 is not visible on fluorescent dissection microscopes. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous locus tagged with GFP using CRISPR/Cas9. NLS-mCherry co-expressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Please contact Ryan Littlefield prior to publishing work using this strain.

GFP tag inserted into endogenous pat-3 locus; mCherry coexpressed from the endogenous pat-3 promoter via SL2 trans-splicing. mCherry tag inserted into endogenous pat-2 locus; GFP::NLS coexpressed from the endogenous pat-2 promoter via SL2 trans-splicing. Please contact Ryan Littlefield prior to publishing work using this strain.

Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Pharynx and body muscles are green; red fluorescence only in body wall muscles. Please contact Ryan Littlefield prior to publishing work using this strain.

Segregates heterozygotes that display only the unc-82 phenotype: slow but normal movement, disorganized muscle structure, somewhat Egl. stDf7 homozygotes die as embyros. unc-44 unc-82 homozygotes generally die as coiled, poorly-moving larvae.

denEx18 [NLP-29::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.

Rhabditis (Rhabditis) brassicae Southern, 1909. Found 3.10.87 in turf near a bank, Traben-Trarbach (Rheinland-Pfalz/Germany) (leg. M. Nimrich). Literature (description and ecological information): besides original description from Southern, 1909 : Buckley (1931): J. Helminth. 9: 197-204 (about R. broughtonalcocki, this is synonym to R. brassicae).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10047 [unc-14p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10035 [eft-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10077 [pha-4p(I2L)::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10088 [hlh-1p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10079 [unc-54p::his-24::mCherry::let-858 3' UTR + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10115 [egl-5p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs218 [Y57A10C.6p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs222 [C54D10.3p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

gaIs220 [col-93p::HIS-24::mCherry + unc-119(+)]. ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Published in Liu, X., et al., Cell, 2009. 139(6).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10596 [ceh-41p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

gaIs234 [jkk-1p::his-24::mCherry + unc-119(+)]. ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Published in Liu, X., et al., Cell, 2009. 139(6).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs245 [col-34p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10117 [hsp-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs209 [sod-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs239 [trap-2p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs232 [csq-1p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs235 [csq-1p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).

gaIs250 [M02D8.1p::HIS-24::mCherry + unc-119(+)]. ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Published in Liu, X., et al., Cell, 2009. 139(6).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs211 [vha-12p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. oxIs305 [dpy-30p::mCherry::HIS-24::unc-54 3'utr + Cbr-unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10200 [hnd-1p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10166 [dpy-7p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10172 [mml-1p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10178 [elt-6p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10193 [nhr-2p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10224 [lin-39p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10587 [lin-26p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10691 [ref-1p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10716 [sma-9gp::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10184 [ceh-49p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10373 [C50F7.5p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10165 [egl-27p::HIS-24::mCherry + unc-119(+)]. Reference: Liu X, Long F, Peng H, Aerni SJ, Jiang M, Sánchez-Blanco A, Murray JI, Preston E, Mericle B, Batzoglou S, Myers EW, Kim SK. Analysis of cell fate from single-cell gene expression profiles in C. elegans. Cell. 2009 Oct 30;139(3):623-33. doi: 10.1016/j.cell.2009.08.044. PMID: 19879847; PMCID: PMC4709123.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10187 [lin-31p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10180 [kin-18p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10190 [C08B11.3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).