More Fields
Strain Species Genotype
VC1607 C. elegans nlr-1(tm2050) IV/nT1 [qIs51] (IV;V). Show Description
F20B10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2050 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAGTTCTGTGACGTCCCAGT. External right primer: GTCGGCGTTAGATGACTATG. Internal left primer: TACGGCAAAGTGAATGGCTT. Internal right primer: ACAGCTGATCTACCACACTC. Internal WT amplicon: 1775 bp. Deletion size: 1078 bp. Deletion left flank: CAATGAGTTAATTTCCAACAAAATTATTTT. Deletion right flank: GTAAGTGAGTACCGAACTGCTCCGGGCTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2003 C. elegans +/szT1[lon-2(e678)] I; mIs12 II; sec-3(ok2238)/szT1 X. Show Description
F52E4.7. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation, and homozygous for unlinked pharyngeal GFP insertion mIs12 (artifact of strain construction). Balanced lethal heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2238 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain.External left primer: CAATCTTCGAGCCTGGGTAA. External right primer: TACCTTCCAGTCCAGATGCC. Internal left primer: TGAAATGGCGATTTTGATGA. Internal right primer: CATGATATGGCGATGCAAAG. Internal WT amplicon: 2918 bp. Deletion size: 1120 bp. Deletion left flank: TTTCTCCATACTACGTCCTCCGAGACTTGA. Deletion right flank: AATGAAACGATTTCCTCGTTGAGACGTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC228 C. elegans nlg-1(ok259) X. Show Description
C40C9.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2357 C. elegans nlp-38(ok2330) I. Show Description
C01A2.7. External left primer: CGTAAGCATGCCGAAGTTTT. External right primer: GGAATTTGGCATGGAAGTGT. Internal left primer: CCAGCTGGAAATTTTTGGAA. Internal right primer: GGCGGGAAATTCAACTTTTT. Internal WT amplicon: 2632 bp. Deletion size: approximately 1000 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4098 C. elegans hrpk-1(gk5045[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I. Show Description
Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4491 C. elegans nlp-48(gk5563[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
[NOTE: Please see RG5054 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1026 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCAAATGGTAAGTTCTTACATAGGCCCCAG. Right flanking sequence: CGTGGATTTTAATATTAAAGTATCGTCCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4752 C. elegans pad-1(gk5820[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 24013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTCACGCTCTTTCCCCCATTTTTCCCCA. Right flanking sequence: GGGTAGGCAACATTTTTATTTCCAACTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. [NOTE: Maintain this strain with care! Non-GFP animals can quickly overtake a population. GFP expression is mottled: the pharynx can look sort of sectored, with bright portions and dim or non-GFP portions, and some GFP animals will throw only non-GFP progeny.]
VC728 C. elegans atl-1(ok1063) V. Show Description
T06E4.3. Superficially wild type. External left primer: TGAAGCTGGTCCTCTGTCTG. External right primer: AAGAAATGAGTGCCGCAAGT. Internal left primer: TATATCACGGTCTCCTCGGG. Internal right primer: TCTTCAATCTCGCCAAATCC. Internal WT amplicon: 3344 bp. Estimated deletion size: 1400 bp. Breakpoints only narrowed due to extremely poor sequence quality. Deletion of approximately 1400 bp lies between chromosome V coordinates 9640245 and 9642180. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC857 C. elegans +/szT1 [lon-2(e678)] I; C24A8.6(gk413)/szT1 X. Show Description
C24A8.6. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and gk413 homozygotes (sick, often sterile, with body morphology defects, lots of arrested embryos). Also segregates viable gk413 hemizygotes (WT males). Phenotype of homozygote may be suspicious, as deletion appears to affect only an intron. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC862 C. elegans cho-1(ok1069) IV. Show Description
C48D1.3. Superficially wild type.  [NOTE: (06/13/2017) A user has reported that they are unable to identify only ok1069 animals by PCR, so it is possible that this strain carries a deletion/duplication.]  Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC970 C. elegans +/szT1 [lon-2(e678)] I; pdi-6(ok1373)/szT1 X. Show Description
B0403.4. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1373 homozygotes (homozygotes are slow-growing, short, Unc, Egl, starve a plate only with difficulty). Viable hemizygous ok1373 males are also segregated. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VH715 C. elegans hdIs17 I; hdIs10 V; nre-1(hd20) lin-15B(hd126) X. Show Description
hdIs17 [glr-1::YFP + unc-47::YFP + unc-129::YFP + rol-6(su1006)]. hdIs10 [unc-129::CFP + glr-1::YFP + unc-47::DsRed + hsp-16::rol-6(su1006)]. Rollers. Reduced progeny at 25C (almost sterile). RNAi hypersensitive, effective RNAi in the nervous system. unc-47::DsRed is weak and only visible in adults. hsp-16::rol-6 transgene is not effectively Roll. Maintain at 15 or 20C.
VK2733 C. elegans vkEx2733. Show Description
vkEx2733 [nhx-2p::NLS-SV40::CemOrange2::NLSegl-13 + myo-2p::GFP]. Wild-type animals expressing NLS(sv-40)::CemOrange2::NLS(egl-13) under the intestinal-specific nhx-2 promoter. The dual NLS localizes to the nucleus. Pick animals with GFP+ pharynx to maintain. Reference: Thomas
VP198 C. elegans kbIs5. Show Description
kbIs5 [gpdh-1p::GFP + rol-6(su1006)]. Rollers, though not obvious in all animals. Maintain under normal conditions. GFP expressed intestine and hypodermis only during hypertonic stress; not induced by other stressers. Reference: Lamitina T, et al. Proc Natl Acad Sci USA. 2006 Aug 8;103(32):12173-8.
VP303 C. elegans rde-1(ne219) V; kbIs7. Show Description
kbIs7 [nhx-2p::rde-1 + rol-6(su1006)]. Rollers. RNAi effective only in intestine. Maintain under normal conditions. Reference: Espelt MV, et al., J Gen Physiol. 2005 Oct;126(4):379-92.
VP596 C. elegans dvIs19 III; vsIs33 V. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. vsIs33 [dop-3::RFP] V. References: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166. Leung CK, et al. J Vis Exp. 2011 May 19;(51).
VPR133 C. elegans vprEx133. Show Description
vprEx133 [hlh-17p::dat-1p::DsRedExpress2]. DsRed2 expression is driven only by downstream (dat-1) promoter.
VT1142 C. elegans nDf51 V; mir-84(n4037) X; ctIs39. Show Description
ctIs39 [hbl-1::GFP + rol-6(su1006)]. Rollers and GFP+. Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. ctIs39 [hbl-1::GFP]: integrated reporter codes for 133 amino acids of HBL-1 followed by GFP, and contains 1.4 kb of hbl-1 3' UTR plus an NLS. hbl-1::GFP is elevated in the hypodermal syncytium at the L3 stage. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT757 C. elegans lin-28(n719) I; lin-12(n137n460) III. Show Description
Only gives a decent brood size at 20C. At 15C: Muv/Blip. At 20C: some Muv/Blip, some Blip but not Muv. At 25C: Not Muv, but do have Blip (due to lin-12). Egl- at all temps.
VZ892 C. elegans hlh-30(syb1452 [hlh-30::3xFLAG::eGFP]) IV. Show Description
3xFLAG and eGFP tags inserted into the endogenous hlh-30 locus. Superficially wild-type. Diffuse GFP in basal growing conditions and strong nuclear labeling upon diverse stresses like starvation, Staphylococcus aureus infection, arsenite, diethylmaleate, heat shock or levamisole. GFP expression is only visible at high magnification; not discernible with a fluorescence stereoscope. Insertion can be detected by PCR. Forward primer sequence: 5' acgcacgcaactgcttta; Reverse primer (in 3'UTR): 5' aataacctgcgattctgg; Reverse primer (in eGFP): CTTGAAGAAGATGGTACGCTC. Expected products (For&Rev 3'UTR): 910 bp (WT)/1878 bp (syb1452). Expected products (For&Rev eGFP): no band (WT)/811 bp (syb1452). Insertion allele generated by SunyBiotech and out-crossed twice with VZ Lab N2. Reference: Martina JA, et al. EMBO J. 2021 Feb 1;40(3):e105793
WH346 C. elegans unc-119(ed3) III; ojIs34. Show Description
ojIs34 [GFP::car-1 + unc-119(+)]. N'-tagged GFP::CAR-1 (Y18D10A.17) fusion. Labels P-granules and small cytoplasmic puncta in all cells. Bombardment with pNL1.6::GFP::unc-119 (pfj-1::pie-1 promoter driving GFP::Y18D10A.17 (N-terminal) with unc-119 rescuing fragment).
WM104 C. elegans unc-101(sy216) gsk-3(nr2047)/hIn1 [unc-54(h1040)] I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc, and coilers which give only dead eggs (low brood size).
WM170 C. elegans unc-4(e120) pir-1(tm1496)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and Unc-4 animals which arrest at the L4 stage. Rarely, a recombination will occur and unc-4 and pir-1 will become unlinked. Propagate the strain by picking single WT animals and checking for correct segregation of progeny. 6/2007: Daniel Chavez notes that tm1496 may also delete part of sec-5, which could be responsible for the developmental arrest of tm1496.
WM43 C. elegans gex-3(zu196) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Zygotic phenotype: 100% of gex-3 homozygotes become Egl although they all make a normal looking L3/L4 vulva. Embryonic phenotype: complete loss of morphogenesis - hypodermal cells fail to intercalate or migrate. Received new stock from Erik Lundquist 11/2003.
WS1973 C. elegans opIs56. Show Description
opIs56 [egl-1p::2xNLS::GFP]. opIs56 is a low copy integrant of 3 kb 5' sequence from egl-1 fused to 2xNLS GFP. unc-119(ed3) should be outcrossed. Low basal GFP expression in embryos, meiotic germ cells and several neurons. GFP expression can be induced by ionizing radiation in all germ cells. Best viewed with dissected gonads.
WS5235 C. elegans ccz-1(t2129) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ccz-1 homozygotes (produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
XA780 C. elegans gna-2(qa705)/goa-1(n499) I. Show Description
Heterozygotes are Egl and Paralyzed. Segregate embryonic lethals (n499) homozygotes. Segregates WT animals that lay only non-refractile eggs that fail to hatch. Pick paralyzed Egl worms to maintain (eggs on the plate should all be pale brown and non-refractile; presence of refractile eggs indicates a recombination has occurred). XA780 recombines at a frequency of about 1%.
XE2789 C. elegans pha-1(e2123) III; ccIs4595 IV; wpEx482. Show Description
ccIs4595 [ceh-24::GFP + rol-6(su1006)]. wpEx482 [ceh-17::NLS::TagRFP + pha-1(+)]. Maintain at 25C to retain array. GFP expression in vulval muscles, m8, and set of neurons in the head. The four SIA neurons are marked with both GFP and RFP. Can be used to isolate SIA by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
YY13 C. elegans rrf-3(mg373) II; oxls12. Show Description
oxls12 [unc-47p::GFP + lin-15(+)]. Enhanced RNAi. Sterile at 25 degrees. [NOTE: the genotype of YY13 as previously annotated only as rrf-3(mg373)] References: Pavelec DM, et al. Genetics. 2009 Dec;183(4):1283-95. PMID: 19797044. McIntire SL, et al. Nature. 1997 Oct 23;389(6653):870-6. PMID: 9349821.
ZG611 C. elegans iaIs19. Show Description
iaIs19 [gcy-32p::GFP + unc-119(+)]. Expression of gcy-32::GFP is consistenly observed in AQR, PQR, and URX neurons.
ZM5101 C. elegans hpIs193. Show Description
hpIs193 [nlf-1p::nlf-1::GFP + lin-15(+)]. GFP expression in head and tail neurons, as well as along ventral cord. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043
ZM8607 C. elegans hpIs481. Show Description
hpIs481 [ceh-12p::tomm20::miniSOG::SL2::BFP + unc-129(DB)p::tomm20::miniSOG::SL2::BFP + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. unc-129(DB)p is a fragment of the unc-129 promoter driving expression in only DB motor neurons (described in Colavita et al., Science 1998 31;281(5377):706-9). The ceh-12 promoter drives expression in VB motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9062 C. elegans hpIs583. Show Description
hpIs583 [acr-2(s)p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of A- and B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. acr-2s(p) is a 1.8 kb fragment of the acr-2 promoter driving expression in only A- and B- class motor neurons (described in Jospin et al, 2009 PLoS Biol. Dec;7(12):e1000265). Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9624 C. elegans lin-15(n765) X; hpIs675. Show Description
hpIs675 [rgef-1p::GCaMP6s::3xNLS::mNeptune + lin-15(+)]. Worms express GCaMP6s and mNeptune in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446
ZR2 C. elegans jmjd-3.1(gk384) X. Show Description
Gonadal enlargement and aberrant gonad migration. Phenotype evident at 25C.