Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PS9675 C. elegans syIs840; syIs300. Show Description
syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs840 [T09B9.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons.
PS9676 C. elegans syIs841; syIs300. Show Description
syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs841 [nlp-20p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons.
PS9893 C. elegans syIs844; syIs300. Show Description
syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs844 [srd-36p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ASK neurons.
PS9896 C. elegans syIs852; syIs300. Show Description
syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs852 [C50F7.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons.
PT2351 C. elegans him-5(e1490) V; myEx741. Show Description
myEx741 [pdfr-1p(3kb)::NLS::RFP + unc-122::GFP]. Him. Pick RFP+ and GFP+ to maintain. Reference: Barrios A, et al. Nat Neurosci. 2012 Dec;15(12):1675-82.
QC134 C. elegans nduf-7(et19) I; zcIs9 V. Show Description
zcIs9 [hsp-60::GFP + lin-15(+)]. Constitutively activated mitochondrial UPR and an extended lifespan. [NOTE: This strains was previously described as only nduf-7(et19). It is in fact carrying the zcIs9 transgene.] Reference: Rauthan M, et al. G3 (Bethesda). 2015 Jun 1. pii: g3.115.018598.
QG1 C. elegans qgIR1 (X, CB4856>N2) X. Show Description
qgIR1 (X, CB4856>N2, haw102573 to 4,822,488) X. The strain is a nearly isogenic line that carries the CB4856 version of npr-1 in an otherwise N2 genetic background. NIL derived from RIAIL QX58 linked then unlinked to mec-2 from CB3273 lon-2 mec-2, then backcrossed to lon-2 for 12 generations selecting nonLon worms, then homozygosed. Genotyped N2 at pkP6106 and pkP6145. Based on QG613 sequencing, interval is from X:4,754,307-4,864,273.
QV224 C. elegans dvIs19 III; skn-1(zj15) IV. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.
RAF2181 C. elegans ieSi57 II; daf-2(bch-40[AID*::3xFLAG::STOP::SL2::SV40::AID*::wrmScarlet::egl-13NLS]) unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.
RB1340 C. elegans nlp-1(ok1469) X. Show Description
C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1341 C. elegans nlp-1(ok1470) X. Show Description
C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1372 C. elegans nlp-18(ok1557) II. Show Description
F33A8.2 Homozygous. Outer Left Sequence: agtggaatcggatgatcgac. Outer Right Sequence: cccaacaatccatgatttcc. Inner Left Sequence: gcaaagaaattaggcgaacg. Inner Right Sequence: aaagctcacggagccaagta. Inner Primer PCR Length: 2326. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1396 C. elegans nlp-20(ok1591) IV. Show Description
F45E4.8 Homozygous. Outer Left Sequence: caacggggaggaagactgta. Outer Right Sequence: atgtcgtcctccagaaatgg. Inner Left Sequence: tgttgatttacgcgaagctg. Inner Right Sequence: tgtacaattggcagacccaa. Inner Primer PCR Length: 2482. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1428 C. elegans lec-3&nlt-1(ok274) II. Show Description
ZK892.1, ZK892.2. Superficially wild type. Outer Left Sequence: GCACCGTATCCCACTCAACT. Outer Right Sequence: GTACCACCAGCTCCGTTCAT. Inner Left Sequence: ATGGGGATGTTGTCCTGAAC. Inner Right Sequence: AAACTTTTGATGGCGGTCAC. Inner Primer WT PCR Product: 3275. Deletion size: 1855 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1609 C. elegans nlp-5(ok1981) II. Show Description
F35C11.1. Homozygous. Outer Left Sequence: AGATGCCGACGTCAATTTTC. Outer Right Sequence: ACTGTTGGGCCATACTCGAC. Inner Left Sequence: AATTCGGCTCAAAAAGCTCA. Inner Right Sequence: AGGGACCGAAGAGTGGATTT. Inner Primer PCR Length: 2278 bp. Deletion Size: 1477 bp. Deletion left flank: GCGTTCCAAATTTTATATCAACGGTTGATG. Deletion right flank: AAATTAATTTACCAGTTTATTGTATTGTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2030 C. elegans nlp-3(ok2688) X. Show Description
F48C11. Homozygous. Outer Left Sequence: ATACCCGCCATCATCTCAAA. Outer Right Sequence: TATTTCGGTATCTGCCGAGC. Inner Left Sequence: TCAGCAGCACTTGACAAACA. Inner Right Sequence: AAAATGTTCTTGACGCGGAG. Inner Primer PCR Length: 3211 bp. Deletion Size: 1618 bp. Deletion left flank: AACCCAAGTTGCTACAAATCATTTGAAACA. Deletion right flank: TGCTTACAATGAACAATTGTGTCCCGGATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2498 C. elegans nlp-17(ok3461) IV. Show Description
Y45F10A.5 Homozygous. Outer Left Sequence: agcttccggtcaggttcttt. Outer Right Sequence: aaaaggtgaacgatgaacgg. Inner Left Sequence: aaccaccacatttttggtaaaga. Inner Right Sequence: agggggtgacgtttttgagt. Inner Primer PCR Length: 1236. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB607 C. elegans nlp-12(ok335) I. Show Description
M01D7.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3039 C. elegans spe-36(ve539[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49] IV; +/nT1 V. Show Description
F40F11.4. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, lays only oocytes. Deletion of 2632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate2 (ve539 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcacaaaaactcacAAATAACTTTGTACCG ; Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAATACATA. sgRNA #1: acAAATAACTTTGTACCGGG; sgRNA #2: CTTCATAGCTCTTGCGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3440 C. elegans rnp-7(ve940[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III.  Maintain by picking GFP+ Rollers (GFP expression in both pharynx and distal tip cells). Heterozygotes are Rol GFP+ (GFP expression in both pharynx and distal tip cells), and segregate Rol GFP+ (GFP expression in both pharynx and distal tip cells), non-Rol GFP+ (GFP only in pharynx) ve940 homozygotes (Unc, arrest as larvae with a curled tail). qC1[qIs26] is homozygous lethal (unknown stage). Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCTTCGATATCCACCACCGGATCCTCCA; Right flanking sequence: TGGAAGATATTGCACTGGTGGTCGTGCTTC. rnp-7 sgRNA A: GGAAGCCGATACAGTACAGG; rnp-7 sgRNA B: ACTAGTAGGTCCTGGCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3541 C. elegans +/mT1 [umnIs52] II; spe-21(ve1041[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Semi sterile. Deletion of 1602 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 ve1041 homozygotes (mostly sterile; see below), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Most ve1051 homozygotes lay only oocytes, but a few escaper ve1041 GFP+ hemaphrodites can lay small broods of similarly semi-sterile progeny. Left flanking Sequence: GCGAGATTTGGTAACTGAAAAAGGTAACCA; Right flanking sequence: ATTCGGCAAAATCAGATAATAAGAAATTCG. dhhc-5 crRNA A: TGGGTGCATGGACTATTGCA; dhhc-5 crRNA B: GTGGTTGGAACGCACAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5054 C. elegans +/mT1 [umnIs52] II; : nlp-48(gk5563[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5563 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4491 and CGC66. gk5563 is a 1026 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAATGGTAAGTTCTTACATAGGCCCCAG; Right flanking sequence: CGTGGATTTTAATATTAAAGTATCGTCCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RJP3221 C elegans rpIs109. Show Description
rpIs109 [dpy-7p::NLS::dsRed2 + rol-6(su1006)]. Nuclear red fluorescence in hypodermal cells. Reference: Romanos TR, et al. Sci Rep. 2017 Aug 4;7(1):7294. doi: 10.1038/s41598-017-07876-4. PMID: 28779171.
RJP5296 C. elegans reSi7 I; unc-31(rp166[GFP::TEV::AID*::FLAG::unc-31]) IV. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
RM2209 C. elegans ric-8(md1909) IV. Show Description
Poor growth and fertility at 25C. Grows well at 20C and is more fertile than ric-8(md303). Degree of aldicarb resistance is similar to md303 but locomotion rate is greater than md303 and embryonic lethality is only 19%, versus 29% for md303. Contains a Tc1 transposon insertion in the middle of the ric-8 coding sequence.
RM3054 C. elegans snt-1(md290) II; mdIs126; mdIs129. Show Description
mdIs126 [snt-1p::snt-1(genomic; B-stop)::CFP]. mdIs129 [snt-1p::snt-1(genomic; A-stop)::YFP]. snt-1 mutation in genome is rescued by 2 integrated transgenes. snt-1(genomic; B-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6B; also referred to as "snt-1(A only)." snt-1(genomic; A-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6A; also referred to as "snt-1(B only)." Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.
RM3325 C. elegans pha-1(e2123) III; mdEx865. Show Description
mdEx865 [unc-17p::NLS::mCherry + pha-1(+)]. Transcriptional reporter. Nuclear localized mCherry in cholinergic neurons. Maintain at 20-25C to retain array. References: Grundahl K and Rand J, unpublished. Granato M, Schnabel H, and Schnabel R, 1994. Genesis of an organ: molecular analysis of the pha-1 gene. Development 120: 3005–3017.
RM580 C. elegans unc-17(md1447) IV. Show Description
md1447 is a spontaneous 465-bp deletion (with a 2-bp insertion) within the unc-17 3'UTR in a TR638 background. Protein level by immunostaining is barely detectible , but unc-17 behavioral phenotypes are relatively mild. Sequence details (in direction of transcription): TCGTAGATTTGGATCTCTGAATATG/Ä465+AA/AGTGATTTCGTATAGAGTAATGTCA . This allele is the only smg-suppressible allele of unc-17 reported thus far. Since the md1447 deletion is entirely within the unc-17 3'UTR, the amino acid sequence of the UNC-17 protein is completely wild-type. Therefore the phenotype derives from the nonsense-mediated decay of the transcript which in turn leads to an extremely low level of wild-type UNC-17 protein (see figure on following page). Many other unc-17 alleles have reduced immunoreactivity (but more immunoreactivity than md1447) yet significantly stronger behavioral phenotypes than md1447. Therefore, the behavioral phenotypes of these other alleles are not due to reduced transporter. Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
RP3497 C elegans idpc-1(knu1089[Y47D3B.6::mGreenLantern]) III. Show Description
mGreenLantern tag inserted at the C-terminus of the endogenous idpc-1/Y47D3B.6 locus. mGreenLantern expression in the pharyngeal cuticle. Reference: Kamal M, et al. "A Spatiotemporal Reconstruction of the C. elegans Pharyngeal Cuticle Reveals a Structure Rich in Phase-Separating Proteins." https://www.biorxiv.org/content/10.1101/2022.03.11.483951v1
RSL123 C. elegans dpy-10(cn64) rab-3(ftw79) II. Show Description
rab-3(ftw79[rab-3::SL2::LoxP::GFP::NLS::3'UTR::Abeta(inv)::sigPep(inv)::T2A(inv)::wrmScarlet11(inv)::LoxP(inv)]) II. Modified endogenous rab-3 locus co-expresses stochastic, switchable cassette by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. Inverted LoxP sites flank the GFP-NLS and inverted wrmScarlet11::T2A::signalPeptide::Abeta insert. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL47 C. elegans unc-54(ftw19[NLS::mCherry::SL2::GFP::unc-54]) I; myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. Show Description
unc-54(ftw19[NLS::mCherry::SL2::GFP::unc-54]) I. myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. Endogenous unc-54 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Endogenous myo-3 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL48 C. elegans tni-3(ftw13[tni-3::mCherry::SL2::GFP::NLS]) V. Show Description
Endogenous tni-3 locus tagged with mCherry using CRISPR/Cas9. GFP-nls coexpressed from the endogenous promoter using SL2 trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL49 C. elegans unc-94(ftw3[GFP::unc-94]) I; tni-3(ftw13[tni-3::mCherry::SL2::GFP::NLS]) V. Show Description
GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. mCherry tag inserted into endogenous tni-3 locus; GFP::NLS coexpressed from the endogenous tni-3 promoter via SL2 trans-splicing. GFP::UNC-94 is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. GFP::UNC-94 is not visible on fluorescent dissection microscopes. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL50 C. elegans myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. Show Description
Endogenous myo-3 locus tagged with mCherry using CRISPR/Cas9. nls-GFP coexpressed from the endogenous promoter using trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL51 C. elegans unc-94(ftw3[GFP::unc-94]) I; myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. Show Description
GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. mCherry tag inserted into endogenous myo-3 locus; GFP::NLS coexpressed from the endogenous myo-3 promoter via SL2 trans-splicing. GFP::UNC-94 is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. GFP::UNC-94 is not visible on fluorescent dissection microscopes. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL52 C. elegans unc-54(ftw19[NLS::mCherry::SL2::GFP::unc-54]) I. Show Description
Endogenous locus tagged with GFP using CRISPR/Cas9. NLS-mCherry co-expressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL66 C. elegans pat-3(ftw41[pat-3::GFP::SL2::mCherry]) pat-2(ftw30[pat-2::mCherry::SL2::GFP]) III. Show Description
GFP tag inserted into endogenous pat-3 locus; mCherry coexpressed from the endogenous pat-3 promoter via SL2 trans-splicing. mCherry tag inserted into endogenous pat-2 locus; GFP::NLS coexpressed from the endogenous pat-2 promoter via SL2 trans-splicing. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL99 C. elegans muIs257 I; unc-22(ftw65[unc-22(partial)::wrmScarlet11::SL2::GFP::unc-22(partial)]) IV. Show Description
Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Pharynx and body muscles are green; red fluorescence only in body wall muscles. Please contact Ryan Littlefield prior to publishing work using this strain.
RW1350 C. elegans unc-44(e362) unc-82(e1323)/stDf7 IV. Show Description
Segregates heterozygotes that display only the unc-82 phenotype: slow but normal movement, disorganized muscle structure, somewhat Egl. stDf7 homozygotes die as embyros. unc-44 unc-82 homozygotes generally die as coiled, poorly-moving larvae.
SAL140 C. elegans pha-1(e2123) III; denEx18. Show Description
denEx18 [NLP-29::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.
SB193 Rhabditis brassicae Show Description
Rhabditis (Rhabditis) brassicae Southern, 1909. Found 3.10.87 in turf near a bank, Traben-Trarbach (Rheinland-Pfalz/Germany) (leg. M. Nimrich). Literature (description and ecological information): besides original description from Southern, 1909 : Buckley (1931): J. Helminth. 9: 197-204 (about R. broughtonalcocki, this is synonym to R. brassicae).
SD1333 C. elegans ccIs4251 I; stIs10047. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10047 [unc-14p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1340 C. elegans ccIs4251 I; stIs10035. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10035 [eft-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1345 C. elegans ccIs4251 I; stIs10077. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10077 [pha-4p(I2L)::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1346 C. elegans ccIs4251 I; stIs10088. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10088 [hlh-1p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1347 C. elegans ccIs4251 I; stIs10079. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10079 [unc-54p::his-24::mCherry::let-858 3' UTR + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).
SD1395 C. elegans ccIs4251 I; stIs10115. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10115 [egl-5p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1408 C. elegans ccIs4251 I; gaIs218. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs218 [Y57A10C.6p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1421 C. elegans ccIs4251 I; gaIs222. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs222 [C54D10.3p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
SD1432 C. elegans ccIs4251 I; gaIs220. Show Description
gaIs220 [col-93p::HIS-24::mCherry + unc-119(+)]. ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Published in Liu, X., et al., Cell, 2009. 139(6).