| PHX7377 |
C. elegans |
nlp-7b(syb7377[nlp-7b::SL2::GFP::H2B]) X. Show Description
Endogenous nlp-7 locus (B-isoform) tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX7394 |
C. elegans |
nlp-36(syb7394[nlp-36::SL2::GFP::H2B]) III. Show Description
Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX7422 |
C. elegans |
nlp-39(syb7422[nlp-39::SL2::GFP::H2B]) I. Show Description
Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX7428 |
C. elegans |
nlp-15(syb7428[nlp-15::SL2::GFP::H2B]) I. Show Description
Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX7537 |
C. elegans |
nlp-20(syb7537[nlp-20::SL2::GFP::H2B]) IV. Show Description
Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX7564 |
C. elegans |
nlp-79(syb7564[nlp-79::SL2::GFP::H2B]) IV. Show Description
Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX8127 |
C. elegans |
srm-1(syb8127[unc-25p(fragment)::SL1-aaaa::FLP D5::let-858 3’UTR]) IV. Show Description
srm-1(syb8127[dpy-10 sgRNAsite::unc-25 fragment with tataa sites::dpy-10 sgRNAsite::SL1-aaaa::FLP D5::let-858 3’utr]) (IV:5015000). FLP D5 recombinase driver expressed from a fragment of the unc-25 promoter that expresses in RME neurons. Recombination was only modestly penetrant. Promoter construct contains dpy-10 sites allowing for a straightforward exchange of the promoter. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
|
|
| PJ1271 |
C. elegans |
daf-4(m592) III; ccIs55 V; daf-3(e1376) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. daf-4 is temperature-sensitive and dauer formation (not body size) phenotype is suppressed by daf-3. Dauers will form only when plates are crowded, starved, and maintained at 26C. Animals are small at 25C.
|
|
| PJ1277 |
C. elegans |
ccIs4251 I; unc-51(e369) ccIs55 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. ccIs55 [unc-54::lacZ + sup-7(st5)] V. GFP expression in nuclei and mitochondria of muscle cells.
|
|
| PQ535 |
C. elegans |
alg-1(ap428 [alg-1::Y45F10D.4 3'UTR]) X. Show Description
alg-1(ap428 [alg-1::Y45F10D.4 3’UTR]) X. alg-1 control strain. ap428 is a CRISPR-engineered allele in which the endogenous alg-1 3'UTR was replaced by the Y45F10D.4 3'UTR. The Y45F10D.4 3'UTR was chosen because it appears to be stably expressed, is commonly used as a control gene in quantitative RT-PCR experiments, and its short 3’UTR lacks ALG-1 binding sites. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.
|
|
| PS10162 |
C. elegans |
nlp-50(sy2074) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-50. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gcagtttcacacaaaccATGCGCTTCTCCGTCT. Right flanking sequence: TTGTTGCTCTATTTGCTCTTCTTGCTGTCTCTTATG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCAAATAGAGCAACAAAGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10165 |
C. elegans |
nlp-51(sy2053) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtttttcttcagtttcaaatcaaaATGCGATTCCTCA. Right flanking sequence: TCTTGGCTCTCCTCGTGCTCTTCGCCATCACCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAAAATGCGATTCCTCATCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS295 |
C. elegans |
let-23(sy97) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozgyotes are WT and segregate WT, DpyUncs and Vulvaless Unc-4s. sy97 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS302 |
C. elegans |
let-23(sy10) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. sy10 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS6844 |
C. elegans |
syIs301 V. Show Description
syIs301
[myo-2p:NLS::GAL4SC::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. myo-2 cGAL driver for pharyngeal muscle. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6916 |
C. elegans |
syIs317 II. Show Description
syIs317 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript]. nlp-40 cGAL driver for intestine. NOTE: Incorrectly annotated as being on LG III in paper; actually should be on LG II. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6934 |
C. elegans |
syIs319 III. Show Description
syIs319 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] III. nlp-40 cGAL driver for the intestine. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6935 |
C. elegans |
syIs320 V. Show Description
syIs320 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] V. nlp-40 cGAL driver for intestine. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6936 |
C. elegans |
syIs321 I. Show Description
syIs321 [myo-3p::NLS::GAL4SK::VP64::unc-54
3'UTR + myo-2p::NLS::mCherry + pBlueScript]. myo-3 cGAL driver for body wall muscle. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6961 |
C. elegans |
syIs334 X. Show Description
syIs334 [rab-3p::NLS::GAL4SK::VP64::let-858
3'UTR + unc-122p::RFP + pBlueScript]. rab-3 cGAL driver for the whole nervous system. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6963 |
C. elegans |
syIs336 X. Show Description
syIs336 [rab-3p::NLS::GAL4SK::VP64::let-858
3'UTR + unc-122p::RFP + pBlueScript]. rab-3 cGAL driver for the whole nervous system. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7154 |
C. elegans |
syIs391 IV. Show Description
syIs391 [myo-2p::NLS::GAL4SK::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. myo-2 cGAL driver for pharyngeal muscle. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7155 |
C. elegans |
syIs392. Show Description
syIs392 [unc-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for Cholinergic neurons. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7160 |
C. elegans |
syIs393 IV. Show Description
syIs393 [unc-47p::NLS::GAL4SK::VP64::let-858
3'UTR + unc-122p::RFP + pBlueScript]. unc-47 cGAL driver for GABAergic neurons. Relatively weak expression. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7167 |
C. elegans |
syIs396 syIs337 III. Show Description
syIs396 [unc-47p::NLS::NLS::GAL4SK::VP64::let-858
3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].
syIs337 [15xUAS::Δpes-10::GFP::let-858
3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. syIs396 is unc-47 cGAL driver for GABAergic neurons. syIs337 is GFP cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7169 |
C. elegans |
syIs337 syIs398 III. Show Description
syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. syIs398 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. syIs337 is a GFP cGAL effector. syIs398 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7171 |
C. elegans |
syIs337 III; syIs400 V. Show Description
syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III. syIs400 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)] V. syIs337 is a GFP cGAL effector. syIs400 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7172 |
C. elegans |
syIs337 syIs401 III. Show Description
syIs337 [15xUAS::Δpes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III.
syIs401 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. syIs337 is a GFP cGAL effector. syIs401 is hsp-16.41 cGAL driver for heat
shock promoter. Low levels of GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7200 |
C. elegans |
syIs420 IV. Show Description
syIs420
[15xUAS::Δpes-10::tetx::let-858 3'UTR + myo-2p::NLS::GFP + pBlueScript]. Tetanus toxin cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7201 |
C. elegans |
syIs421 IV. Show Description
syIs421
[15xUAS::Δpes-10::tetx::let-858 3'UTR + myo-2p::NLS::GFP + pBlueScript]. Tetanus toxin cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7203 |
C. elegans |
syIs423 V. Show Description
syIs423
[15xUAS::Δpes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)]. GCaMP6s cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7521 |
C. elegans |
syIs483 X; syIs300. Show Description
syIs483 [unc-17p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + ceh-19p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] X. Split cGAL driver for MC neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7829 |
C. elegans |
syIs493 I. Show Description
syIs493 [sra-9p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASK neurons.
|
|
| PS7973 |
C. elegans |
syIs526 III. Show Description
syIs526 [flp-24p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALA neurons.
|
|
| PS8027 |
C. elegans |
nlp-67(sy1176) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-67;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CTCACTTTCTTGCTCGTCACTCTTTTTGCCCTCGC
Right flanking sequence: CAATGTCATGCAAGCACAGCGTTACGATCGAGCC
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTGCTTGCATGACATTGGCG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8131 |
C. elegans |
syIs530; syIs300 Show Description
syIs530 [ceh-63p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for DVC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS8132 |
C. elegans |
syIs532; syIs300 Show Description
syIs532 [hlh-34p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AVH neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS8189 |
C. elegans |
nlp-76(sy1214) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-76;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: cagTGTTCATCGCAATCTGCGTGCTCTCCCAAAA
Right flanking sequence: CGCTATGGCCCTCCGTGGTGCACTATTCCGTTCTG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CACGGAGGGCCATAGCGTTT
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8191 |
C. elegans |
nlp-77(sy1216) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-77;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GACAACCAGCCGGAGGTCAAGATGTTCCACCATTC
Right flanking sequence: CTTCGTAATGCCACTCCAGCTCAACTTCAGAGCTTC
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAA
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8279 |
C. elegans |
syIs537; syIs300 Show Description
syIs537 [glr-3p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RIA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS8282 |
C. elegans |
syIs554; syIs300 Show Description
syIs554 [nmr-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + flp-20p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for PVC neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS8288 |
C. elegans |
syIs559; syIs300 Show Description
syIs559 [flp-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AVK neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS8290 |
C. elegans |
syIs561. Show Description
syIs561 [ttx-3p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AIY neurons.
|
|
| PS8293 |
C. elegans |
syIs564. Show Description
syIs564 [odr-10p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWA neurons.
|
|
| PS8305 |
C. elegans |
nlp-78(sy1262) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-78;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GGCTTTCTCAAACATCTGTAGTGCGTATCCAGAT
Right flanking sequence: TATCGACTTCCTGAAAGAgtaagttttgagaatttg
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTTCAGGAAGTCGATAATC
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8307 |
C. elegans |
nlp-80(sy1264) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-80;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CTTCTCTTGTGTATTCTGTTTGCTTTATCCGAAG
Right flanking sequence: CTTACAGTCGCATGGAGTTGGAgtaagttaagaac
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTCCATGCGACTGTAAGCTT
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8311 |
C. elegans |
nlp-82(sy1266) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-82;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: cattttccaactataaattttacagATGCCGTCA
Right flanking sequence: TACCACACTGTAATCATCATCCTGCTCATCTCAAT
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATGATTACAGTGTGGTATGA
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8313 |
C. elegans |
nlp-79(sy1268) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-79;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: aaattaaattcaacttttcaggtaaaATGTCCACT
Right flanking sequence: CGGTGGTTTGTGTTCGTCGCCCTGATGGCTCTCG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAGGTAAAATGTCCACTCGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8373 |
C. elegans |
syIs595. Show Description
syIs595 [mec-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALM, AVM, PLM, and PVM neurons.
|
|
| PS8409 |
C. elegans |
syIs569; syIs300 Show Description
syIs569 [nmr-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + flp-7p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for AVG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
