| PHX3317 |
C. elegans |
flp-11b(syb3317[flp-11b::T2A::3XNLS::GFP]) X Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
|
|
| PHX3319 |
C. elegans |
nlp-22(syb3319[nlp-22::T2A::3×NLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3320 |
C. elegans |
nlp-49(syb3320[nlp-49::T2A::3XNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| PHX3321 |
C. elegans |
ntc-1(syb3321[ntc-1::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3323 |
C. elegans |
flp-14(syb3323[flp-14::T2A::3xNLS::GFP]) III. Show Description
Endogenous flp-14 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| PHX3330 |
C. elegans |
pdf-1(syb3330[pdf-1::T2A::3xNLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3334 |
C. elegans |
flp-24(syb3334[flp-24::T2A::3×NLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3372 |
C. elegans |
rgba-1(syb3372[rgba-1::T2A::3xNLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3373 |
C. elegans |
nlp-70(syb3373[nlp-70::T2A::3xNLS::GFP]) V. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3384 |
C. elegans |
nlp-64(syb3384[nlp-64::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3388 |
C. elegans |
nlp-38(syb3388[nlp-38::T2A::3xNLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3411 |
C. elegans |
nlp-13(syb3411[nlp-13::T2A::3xNLS::GFP]) V. Show Description
Endogenous nlp-13 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| PHX3436 |
C. elegans |
flp-4(syb3436[flp-4::T2A::3XNLS::GFP]) II. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX3588 |
C. elegans |
flp-26(syb3588[flp-26::T2A::3xNLS::GFP]) X. Show Description
Endogenous flp-26 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
|
|
| PHX3936 |
C. elegans |
nlp-51(syb3936[nlp-51::SL2::GFP::H2B]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
|
|
| PHX4399 |
C. elegans |
nlp-82(syb4399[nlp-82::SL2::GFP::H2B]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-82 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX4406 |
C. elegans |
nlp-73(syb4406 [nlp-73::SL2::GFP::H2B]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-73 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| PHX4512 |
C. elegans |
nlp-69(syb4512[nlp-69::SL2::gfp::H2B]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
|
|
| PHX530 |
C. elegans |
nlp-11(syb530) II. Show Description
Superficially wild-type. syb530 is a 2042 bp deletion of the entire nlp-11 gene. Flanking sequences: tatttctcctattgagtgcaaaaaagagtgaaa-acatcaacaaataaaataccataccaacgagt Primers for genotyping: Fwd: gtcctcaccattcccctagg Interal (fwd): TCTGATCGACGCTGGAAAGA Rev: gaataggaagagggcggagg PCR product: WT 264 bp / syb530 -- ; WT 2551 bp / syb530 509 bp. Reference: Konietzka J, et al. Curr Biol. 2020 Jan 6;30(1):1-16.e13. doi: 10.1016/j.cub.2019.10.048. PMID: 31839447
|
|
| PHX5697 |
C. elegans |
nlp-2(syb5697 [nlp-2::SL2::GFP::H2B]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
|
|
| PHX5804 |
C. elegans |
egl-3(syb5804[flag::NLS::Cre::SL2::egl-3]) V. Show Description
Cre inserted into the endogenous egl-3 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX5859 |
C. elegans |
ceh-48(syb5859[flag::NLS::Cre::SL2::ceh-48]) IV. Show Description
Cre inserted into the endogenous ceh-48 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX7352 |
C. elegans |
nlp-29(syb7352[nlp-29::SL2::GFP::H2B]) V. Show Description
Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX7377 |
C. elegans |
nlp-7b(syb7377[nlp-7b::SL2::GFP::H2B]) X. Show Description
Endogenous nlp-7 locus (B-isoform) tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX7394 |
C. elegans |
nlp-36(syb7394[nlp-36::SL2::GFP::H2B]) III. Show Description
Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX7422 |
C. elegans |
nlp-39(syb7422[nlp-39::SL2::GFP::H2B]) I. Show Description
Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX7428 |
C. elegans |
nlp-15(syb7428[nlp-15::SL2::GFP::H2B]) I. Show Description
Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX7537 |
C. elegans |
nlp-20(syb7537[nlp-20::SL2::GFP::H2B]) IV. Show Description
Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX7564 |
C. elegans |
nlp-79(syb7564[nlp-79::SL2::GFP::H2B]) IV. Show Description
Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PJ1271 |
C. elegans |
daf-4(m592) III; ccIs55 V; daf-3(e1376) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. daf-4 is temperature-sensitive and dauer formation (not body size) phenotype is suppressed by daf-3. Dauers will form only when plates are crowded, starved, and maintained at 26C. Animals are small at 25C.
|
|
| PJ1277 |
C. elegans |
ccIs4251 I; unc-51(e369) ccIs55 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. ccIs55 [unc-54::lacZ + sup-7(st5)] V. GFP expression in nuclei and mitochondria of muscle cells.
|
|
| PQ535 |
C. elegans |
alg-1(ap428 [alg-1::Y45F10D.4 3'UTR]) X. Show Description
alg-1(ap428 [alg-1::Y45F10D.4 3UTR]) X. alg-1 control strain. ap428 is a CRISPR-engineered allele in which the endogenous alg-1 3'UTR was replaced by the Y45F10D.4 3'UTR. The Y45F10D.4 3'UTR was chosen because it appears to be stably expressed, is commonly used as a control gene in quantitative RT-PCR experiments, and its short 3UTR lacks ALG-1 binding sites. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.
|
|
| PS10162 |
C. elegans |
nlp-50(sy2074) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-50. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gcagtttcacacaaaccATGCGCTTCTCCGTCT. Right flanking sequence: TTGTTGCTCTATTTGCTCTTCTTGCTGTCTCTTATG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCAAATAGAGCAACAAAGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS10165 |
C. elegans |
nlp-51(sy2053) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtttttcttcagtttcaaatcaaaATGCGATTCCTCA. Right flanking sequence: TCTTGGCTCTCCTCGTGCTCTTCGCCATCACCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAAAATGCGATTCCTCATCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| PS295 |
C. elegans |
let-23(sy97) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozgyotes are WT and segregate WT, DpyUncs and Vulvaless Unc-4s. sy97 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS302 |
C. elegans |
let-23(sy10) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. sy10 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| PS6844 |
C. elegans |
syIs301 V. Show Description
syIs301
[myo-2p:NLS::GAL4SC::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. myo-2 cGAL driver for pharyngeal muscle. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6916 |
C. elegans |
syIs317 II. Show Description
syIs317 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript]. nlp-40 cGAL driver for intestine. NOTE: Incorrectly annotated as being on LG III in paper; actually should be on LG II. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6934 |
C. elegans |
syIs319 III. Show Description
syIs319 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] III. nlp-40 cGAL driver for the intestine. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6935 |
C. elegans |
syIs320 V. Show Description
syIs320
[nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] V. nlp-40 cGAL driver for intestine. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6936 |
C. elegans |
syIs321 I. Show Description
syIs321 [myo-3p::NLS::GAL4SK::VP64::unc-54
3'UTR + myo-2p::NLS::mCherry + pBlueScript]. myo-3 cGAL driver for body wall muscle. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6961 |
C. elegans |
syIs334 X. Show Description
syIs334 [rab-3p::NLS::GAL4SK::VP64::let-858
3'UTR + unc-122p::RFP + pBlueScript]. rab-3 cGAL driver for the whole nervous system. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6963 |
C. elegans |
syIs336 X. Show Description
syIs336 [rab-3p::NLS::GAL4SK::VP64::let-858
3'UTR + unc-122p::RFP + pBlueScript]. rab-3 cGAL driver for the whole nervous system. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7154 |
C. elegans |
syIs391 IV. Show Description
syIs391
[myo-2p::NLS::GAL4SK::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. myo-2 cGAL driver for pharyngeal muscle. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7155 |
C. elegans |
syIs392. Show Description
syIs392 [unc-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for Cholinergic neurons. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7160 |
C. elegans |
syIs393 IV. Show Description
syIs393 [unc-47p::NLS::GAL4SK::VP64::let-858
3'UTR + unc-122p::RFP + pBlueScript]. unc-47 cGAL driver for GABAergic neurons. Relatively weak expression. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7167 |
C. elegans |
syIs396 syIs337 III. Show Description
syIs396 [unc-47p::NLS::NLS::GAL4SK::VP64::let-858
3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].
syIs337 [15xUAS::?pes-10::GFP::let-858
3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. syIs396 is unc-47 cGAL driver for GABAergic neurons. syIs337 is GFP cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7169 |
C. elegans |
syIs337 syIs398 III. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. syIs398 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. syIs337 is a GFP cGAL effector. syIs398 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7171 |
C. elegans |
syIs337 III; syIs400 V. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III. syIs400 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)] V. syIs337 is a GFP cGAL effector. syIs400 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7172 |
C. elegans |
syIs337 syIs401 III. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III.
syIs401 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. syIs337 is a GFP cGAL effector. syIs401 is hsp-16.41 cGAL driver for heat
shock promoter. Low levels of GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|