CGC16 |
C. elegans |
hT2 [umnIs5] I; hT2 [bli-4(e937)] III. Show Description
umnIs5 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] I. Homozygous-viable translocation marked with bli-4 and tdTomato. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Derived by insertion of tdTomato transgene into parental strain KR1234 using CRISPR/Cas9.
|
|
CGC161 |
C. elegans |
mir-266(umn68[mir-266p::SL1::EGL13NLS::lox2272)] X. Show Description
Deletion of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
|
|
CGC162 |
C. elegans |
mir-266(umn69[mir-266p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
|
|
CGC163 |
C. elegans |
mir-271(umn70[mir-271p::SL1::EGL13NLS::lox2272)] X. Show Description
Deletion of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
|
|
CGC164 |
C. elegans |
mir-271(umn71[mir-271p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
|
|
CGC165 |
C. elegans |
mir-784(umn72[mir-784p::SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
|
|
CGC166 |
C. elegans |
mir-784(umn73[mir-784p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. Show Description
mScarlet replacement of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
|
|
CGC167 |
C. elegans |
mir-787(umn74[mir-787p::SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
|
|
CGC168 |
C. elegans |
mir-787(umn75[mir-787p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. Show Description
mScarlet replacement of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
|
|
CGC169 |
C. elegans |
mir-788(umn76[mir-788p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-788 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG.
|
|
CGC17 |
C. elegans |
unc-4(e120)/mT1 [umnIs6] II; dpy-17(e164)/mT1 [dpy-10(e128)] III. Show Description
umnIs6 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] II. Heterozygotes are WT with dim red fluorescence, and segregate WT with dim red fluorescence, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes with more intense red fluorescence), and DpyUnc with no red fluorescence. Pick WT with dim red fluorescence and check for correct segregation of progeny to maintain.
|
|
CGC170 |
C. elegans |
mir-788(umn77[mir-788p+SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-788 pre-miRNA via CRISPR/CAS9. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG.
|
|
CGC171 |
C. elegans |
mir-799(umn78[mir-799p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-799 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.
|
|
CGC172 |
C. elegans |
mir-799(umn79[mir-799p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-799 pre-miRNA via CRISPR/CAS9. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.
|
|
CGC177 |
C. elegans |
lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
|
|
CGC179 |
C. elegans |
mir-82(umn86[mir-82p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-82 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.
|
|
CGC180 |
C. elegans |
mir-82(umn87[mir-82p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-82 pre-miRNA via CRISPR/CAS9. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.
|
|
CL183 |
C. elegans |
him-5(e1490) srf-4(ct109) V. Show Description
Animals commonly have a protruding vulva. Unc (slow moving and non-sinusoidal body posture). Egl. Ectopic surface binding of the lectins WGA and SBA. Males are infertile and Mab-crumpled spicules and abnormal rays and lack diagonal sex muscles.
|
|
CL208 |
C. elegans |
srf-9(dv4) him-5(e1490) V. Show Description
Animals are somewhat smaller than WT and commonly have a protruding vulva. Unc(slow moving and non-sinusoidal body posture). Egl. Ectopic surface binding of the lectins WGA and SBA. Males are infertile and Mab.
|
|
CL2166 |
C. elegans |
dvIs19 III. Show Description
dvIs19 [(pAF15)gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP.
|
|
CL4176 |
C. elegans |
smg-1(cc546) I; dvIs27 X. Show Description
dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by "chunking", which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations.
|
|
CL6180 |
C. elegans |
smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66.
|
|
CL691 |
C. elegans |
dvIs19 III; skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.
|
|
CU7905 |
C. elegans |
smIs350 IV; unc-76(e911) V. Show Description
smIs350 [hsp-16::mCherry-NLS + tra-2::FLAG(3x) + unc-76(+)] IV. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.
|
|
CX5463 |
C. elegans |
slt-1(ok255) X. Show Description
Viable. Can be scored only using special neuronal markers such as zdIs5, which labels the touch cells and shows that they have aberrant anterior processes in the slt-1 mutant.
|
|
CZ16143 |
C. elegans |
juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. Show Description
juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. Pick RFP+ to maintain. RFP expression in AIY neuron. Weak light green signals were observed in the neurons using compound scope although this is only the former half of the split GFP. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.
|
|
CZ17515 |
C. elegans |
juSi94 II; rps-18(ok3353) IV. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. Superficially wild-type. No fluorescence; carries only one portion of a split GFP reporter for visualization of ribosomes. Allows inducible GFP fluorescence of ribosomes when combined with GFP1-10 expression in tissue of choice. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
|
|
DA1256 |
C. elegans |
lin-15B&lin-15A(n765) X; adEx1256. Show Description
adEx1256 [egl-19::sGFP-NLS + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv. n765 is temperature-sensitive.
|
|
DA1350 |
C. elegans |
adEx1350. Show Description
adEx1350 [kin-18::GFP + rol-6(su1006)]. Pick Rollers. Only about 10% transmission.
|
|
DCR1673 |
C. elegans |
olaEx987. Show Description
olaEx987 [ttx-3p::mCherry::rab-3 + hlh-17p::CD4::GFP(1-10) + ttx-3p::CD4::GFP11 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx987 labels AIY presynaptic sites with mCherry, and AIY and CEPsh contact with GFP. oleEx987 contains GRASP (GFP Reconstitution Across Synaptic Partners) constructs using two GFP fragments, GFP(1-10) and GFP11, that can reconstitute a functional GFP molecule only when they are in close proximity. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
DCR2188 |
C. elegans |
olaEx1316. Show Description
olaEx1316 [ttx-3p::CD4::GFP11 + glr-3p::CD4::GFP(1-10) + ttx-3p::mCherry::rab-3 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1316 labels AIY presynaptic sites with mCherry, and AIY and RIA contact with GFP. oleEx1316 contains GRASP (GFP Reconstitution Across Synaptic Partners) constructs using two GFP fragments, GFP(1-10) and GFP11, that can reconstitute a functional GFP molecule only when they are in close proximity. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
DDP1 |
C. elegans |
uonEx1. Show Description
uonEx1 [unc-54::alpha-synuclein::CFP + unc-54::alpha-synuclein::YFP(Venus)]. No additional transformation marker was included in the array. uonEx1 also known as SC+SV in reference publications. Reduced lifespan (25-35% lower) and reduced pharyngeal pumping rate compared to N2. Novel transgenic strain for monitoring the influence of genetic and/or environmental factors on the extent of alpha-synuclein aggregation using FRET signals. Because the two fusion proteins are separate, FRET is only possible when synuclein aggregation brings a CFP tag very close to a YFP tag within an aggregate. We suggest using this strain in conjunction with the positive control (high FRET) strain DDP2 or with strain NL5901 which shows opposite changes in FRET. References: Nagarajan A, et al. CNS Neurol Disord Drug Targets. 2015 Aug 21. Bodhicharla R, et al. CNS Neurol Disord Drug Targets. 2012 Dec;11(8):965-75.
|
|
DLW112 |
C. elegans |
reSi7 I; unc-104(knu973[unc-104::AID]) II. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
DLW114 |
C. elegans |
reSi7 I; unc-18(knu969[unc-18::AID]) X. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
DM1151 |
C. elegans |
ccar-1(ra20) IV. Show Description
WT in appearance and movement. Some slight muscle disorganization and gonad disorganization. Slightly reduced brood size. Only suppresses the unc-52(e1421) allele.
|
|
DM1152 |
C. elegans |
ccar-1(ra21) IV. Show Description
WT in appearance and movement. Some slight body wall muscle disorganization and gonad disorganization. Slightly reduced brood size. Only suppresses the unc-52(e1421) allele.
|
|
DP38 |
C. elegans |
unc-119(ed3) III; daf-?. Show Description
Unc. Contains an unlinked dauer constitutive mutation. See HT1593 for a stock with the Daf mutation removed.
|
|
DR176 |
C. elegans |
unc-54(e190) I; eDp23 V. Show Description
Suppressed-movement slow. Unlinked double.
|
|
DR1799 |
C. elegans |
daf-7(n696)/unc-45(st604) III. Show Description
WT phenotype. Segregates WT, constitutive dauers and ts mild Uncs. Uncs are maternal-effect lethal: F1 Uncs from a heterozygote produce only arrested 2-fold stage progeny that hatch. Grow at 22.5C (n696 produces nearly 100% dauers at this temperature).
|
|
DR2281 |
C. elegans |
daf-9(m540) X. Show Description
Forms dauer larvae non-conditionally but only arrests at dauer stage for 1-2 days, then grows to adult. daf-c but not ts - can grow at 15C or 20C.
|
|
DV3799 |
C. elegans |
reSi1 I. Show Description
reSi1 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei.
|
|
DV3800 |
C. elegans |
reSi2 II. Show Description
reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei.
|
|
DV3801 |
C. elegans |
reSi3 I. Show Description
reSi3 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei.
|
|
DV3803 |
C. elegans |
reSi5 I. Show Description
reSi5 [ges-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Intestinal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in intestinal nuclei.
|
|
DV3805 |
C. elegans |
reSi7 I. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. NOTE: PCR detection of this insert using the published primers has been reported to be defective. Neuronal-specific expression of blue fluorescent protein is still observed and neuronal-specific depletion of AID-tagged proteins has been reported. As such, the construct is inferred to be functional but will need to be tracked in strain constructions via a different method.
|
|
DV3825 |
C. elegans |
reSi11 II. Show Description
reSi11 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei.
|
|
DV3826 |
C. elegans |
reSi12 II. Show Description
reSi12 [ges-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Intestinal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in intestinal nuclei.
|
|
EG1000 |
C. elegans |
dpy-5(e61) I; rol-6(e187) II; lon-1(e1820) III. Show Description
Dpy suppresses Rol and Lon. Strain appears to be only Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-5 causes extreme dumpiness, rol-6 causes worms to roll over and lie in a "C" shape, and lon-1 worms are about 125% WT length.
|
|
EG1020 |
C. elegans |
bli-6(sc16) IV; dpy-11(e224) V; lon-2(e678) X. Show Description
Dpy suppresses Bli and Lon. Strain appears to be only slightly Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-11 causes dumpiness, bli-6 adult worms develop blisters on their bodies, and lon-2 worms are about 150% WT length.
|
|
EG4443 |
C. elegans |
oxIs253 II; unc-119(ed3) III. Show Description
oxIs253 [unc-122p::GFP + unc-119(+)]. Wild type. Very dim GFP expression in the coelomycytes. Only visible on compound microscope. Plasmid pCFJ68 inserted by MosSCI into ttTi5605 site.
|
|