More Fields
Strain Species Genotype
VH7068 C. elegans Y51B9A.9(hd7068[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1571 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCCCAAATTCGGTCAGTGTACTGAAAATC; Right flanking sequence: CAATAATGCTGAGGAAAAAAGCTTCGAATA. sgRNA #1: TCATCCTTCATTTGTCTGGG; sgRNA #2: GAATTTTCAGGCAACACTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7069 C. elegans gst-41(hd7012[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1003 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGCAACAGAGTGGAATGTTTGCTGATTCCA; Right flanking sequence: TGGCTTCAAGACAACTCACGACTAAAATAA. sgRNA #1: CGAGCCTTGCACAAACTAAT; sgRNA #2: AAAAACAACGGCTGTCTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7070 C. elegans hda-5(hd7070[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATATACCTATTTTCTCCTTGTTTTCCCC; Right flanking sequence: TGGAAAGATCCTCGCTATATTAGAAGGTGG. sgRNA #1: TGATGTTTGACCGATTATGG; sgRNA #2: CTCCTCAGCCAAATTTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7071 C. elegans hda-5(hd7071[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATATACCTATTTTCTCCTTGTTTTCCCC; Right flanking sequence: TGGAAAGATCCTCGCTATATTAGAAGGTGG. sgRNA #1: TGATGTTTGACCGATTATGG; sgRNA #2: CTCCTCAGCCAAATTTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7072 C. elegans C25A6.1(hd7072[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 988 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTGAAACATTTTTCAAGTCATGATTCCA; Right flanking sequence: TTTCCGGTAGAAATTTTCACCAACTTCCCG. sgRNA #1: AATTGCCCGGGAATTTCACC; sgRNA #2: GGTGTCGTTGTTTGTCAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7074 C. elegans Y38H6C.8(hd7074[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1106 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAAGAGATGCTATGACAATCAAGAATAA; Right flanking sequence: ATTTAAGTTTTTTTTATTACAACAAAGTAC. sgRNA #1: ATTAATTCAAAGAAGGGTGG; sgRNA #2: CATCAAATCTCTAGGCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7075 C. elegans W04G5.10(hd7075[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGATTTCGAATCAAATCTTATTTTTTCTTC; Right flanking sequence: TCGTCAAAATGCGTCTCCAAATGTATAAAA. sgRNA #1: TTCTTCTTCGAAACACTCGG; sgRNA #2: ACTCGAGCAATTCAGACTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7076 C. elegans M176.9(hd7076[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2297 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTGCCAGAAGCCTATTTTTCGCTTTTCCC; Right flanking sequence: CTGATTACGACCTTTTAATAGCATAACTTG. sgRNA #1: GAAGATGGGACATTACAGAT; sgRNA #2: CTTTGTAGAAGGGATACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7077 C. elegans F45G2.9(hd7077[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATCGGCACAGCTCGATAAGCCTCAAGTGA; Right flanking sequence: GAGCTTTAACCGCAAATTCGTCTGTTGATT. sgRNA #1: TCCGTAGCGTTATCTCCAGT; sgRNA #2: GTGAGCACAATTACCGAGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7078 C. elegans W01F3.2(hd7078[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGAGAAGAAGAACTGCAACTACTACAGGA; Right flanking sequence: AGGGAAAGAGAATTTGGTGTCAGTAGGTGA. sgRNA #1: ATTCCAGTGATTTCTGTGGG; sgRNA #2: ACACAACGCATCAGTATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7079 C. elegans nhr-228(hd7079[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2424 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTTTCAGAAGAACTGCTTCTGGGAAATGG; Right flanking sequence: GATATTGTTGGTACTCTCCACGAGCTGGAT. sgRNA #1: GATAACCAAAAGTGTCGTGG; sgRNA #2: CATTTCCTTGCAAGCCTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7080 C. elegans tcab-1(hd7080[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 4236 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATAGGAGACGTCCGGATTTGTCGATGGA; Right flanking sequence: CGGTTTTCTGGGATTTCTTCGGGAATTTCT. sgRNA #1: GAATCGTGTACGGTGTGTGG; sgRNA #2: TCTCTTTTCGATTTAATGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7081 C. elegans F26H9.5(hd7081[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATTTTATCCATTTGAGAACGAGATTTGTT; Right flanking sequence: GAAAATTTGTCTTGAATTCTCACAATATCC. sgRNA #1: GTGTAGATACCTCCAGTTGG; sgRNA #2: AGAAATGTCGCATAGATCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7085 C. elegans C25E10.4(hd7085[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCTAAACAGTGCCACTATCCCCATCCG; Right flanking sequence: TGGGCGTTTAATTTGAAAGAATTGAGTAAA. sgRNA #1: TTCTCAAAGGTCCCTTGTGG; sgRNA #2: TTCTTTCAATGGGTGCTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7088 C. elegans cest-32(hd7088[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1914 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTTTTCGAATTTTTGAATTTTGTCACCT; Right flanking sequence: AGGATCTCGAGCTTTTGTTTTTTTTTTCAA. sgRNA #1: GAAAAGAGACTTATACAGGC; sgRNA #2: ACATTTCTCAACTCGTCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7089 C. elegans C50F2.5.1(hd7089[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1885 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAGCACGAATCTACAAACATTTTATTTT; Right flanking sequence: TGGCCCATAATTATGGGGCTCGAGTTGCTC. sgRNA #1: GCAATAGTTCTCAGTTCTCA; sgRNA #2: ACAGAGATTTTACTTCAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7092 C. elegans cyp-33C1(hd7092[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1987 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGGGAATTTGTTGTCTATTGCAAATCCA; Right flanking sequence: CGGACCAGTGGTTGCTCCGAGGTTGTTCAC. sgRNA #1: AAGGCTTTATATCCCGGTGG; sgRNA #2: CCGTCAATGGCCAAAGGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7093 C. elegans acs-21(hd7093[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1797 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGTAAATTAGAAATATTCTAGTTTTAGG; Right flanking sequence: TGGAAGATGAGCAGAAGTTTGAAGAAGATT. sgRNA #1: TATTGTTCATCGATGATGGC; sgRNA #2: AGTTGTGCCGAAGAATATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7094 C. elegans ugt-25(hd7094[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3226 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAAATACGAAGACTACGGAAACTACATTAT; Right flanking sequence: AGGTCTTGGATCAACGAATGAATTGGCTTT. sgRNA #1: TTCAGAACTAATGGGCGGAG; sgRNA #2: ACTGCATTCATGACTCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7095 C. elegans C30A5.4(hd7095[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTTCTTGCGCTTAGCACCGCCCATTTTAAA; Right flanking sequence: AGACCCATGCAGAGAAACTGCTTGTGCCTT. sgRNA #1: ATCAATCAGCGAACTTTTGG; sgRNA #2: CTCCACGATCTCAGCTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7097 C. elegans twk-47(hd7097[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 2010 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACACGGAAACCATACGTTGAAGCCTTTCCA; Right flanking sequence: TGGCAAAGCATCATCACTTATTCCAGAAAT. sgRNA #1: GAAGATGTTGCTTCACTTGG; sgRNA #2: CTTCTTTTAGTCCATCTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7104 C. elegans F25B3.4(hd7104[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 4130 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTGCTGCTTCTACTGCCCCCGTGTCCCG; Right flanking sequence: TGGAATAAGACGTGTCAGCTCCATATCTGT. sgRNA #1: CCGTCCAAATCTCACGTCAC; sgRNA #2: AAAGTTTCTACATCCTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7116 C. elegans adah-1(hd7105 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/tmC25 [unc-5(tm9708)] IV. Show Description
Maintain by picking wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced tmC25. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7105 and FX30257. hd7105 is a deletion of 4581 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7120 C. elegans ubh-1(hd7120[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAATAGCTTACTATTAGCTAGAAAATCCG; Right flanking sequence: GAGCGGCCATATTTAGACAGTTTTTTTGGTTCT. sgRNA #1: GGTTGGAATTGAGGAACGTT; sgRNA #2: TTCGAGCGGAGTCCATGGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7121 C. elegans Y71A12B.10(hd7121[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1854 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCGGAGACACTACACCTTCGAGACTCCT; Right flanking sequence: TGGTGCTCAATGTGCAGTGGCGTTTGGCTC. sgRNA #1: TCTTCAGTATATCCATTCGG; sgRNA #2: CGACTTGACGCTCATCGACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VPR168 C. elegans wyEx915. Show Description
wyEx915 [hlh-17p::mCherry + unc-122p::GFP]. Low penetrance backwards coiler. This strain was produced by crossing TV2394 with N2 to remove wyIs45.
VZ892 C. elegans hlh-30(syb1452 [hlh-30::3xFLAG::eGFP]) IV. Show Description
3xFLAG and eGFP tags inserted into the endogenous hlh-30 locus. Superficially wild-type. Diffuse GFP in basal growing conditions and strong nuclear labeling upon diverse stresses like starvation, Staphylococcus aureus infection, arsenite, diethylmaleate, heat shock or levamisole. GFP expression is only visible at high magnification; not discernible with a fluorescence stereoscope. Insertion can be detected by PCR. Forward primer sequence: 5' acgcacgcaactgcttta; Reverse primer (in 3'UTR): 5' aataacctgcgattctgg; Reverse primer (in eGFP): CTTGAAGAAGATGGTACGCTC. Expected products (For&Rev 3'UTR): 910 bp (WT)/1878 bp (syb1452). Expected products (For&Rev eGFP): no band (WT)/811 bp (syb1452). Insertion allele generated by SunyBiotech and out-crossed twice with VZ Lab N2. Reference: Martina JA, et al. EMBO J. 2021 Feb 1;40(3):e105793
WBM1177 C. elegans wbmIs81. Show Description
wbmIs81 [eft-3p::3XFLAG::GFP::SKL::unc-54 3'UTR *wbmIs65] (V:8645000). Ubiquitous expression of peroxisome-targeted GFP. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. Derived from parental strain WBM1140 by CRISPR-mediated insertion of peroxisome-targeted GFP downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome (wbmIs65). Outcrossed six times to WBM lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.
WE5236 C. elegans pgIR1 (I, CB4856>N2) I. Show Description
pgIR1 (I, CB4856>N2). CB4856 Chromosome I in N2 background.
WF1863 C. elegans cam-1(gm122); cwEx266. Show Description
cwEx266 [cam-1p::cam-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. Unc. GFP-tagged CAM-1 rescues gm122. Generated in N2 background.
WF2183 C. elegans cwEx417. Show Description
cwEx417 [cfz-2p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Generated in N2 background.
WF2575 C. elegans cwEx486. Show Description
cwEx486 [mnp-1p::mnp-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. Generated in N2 background.
WH530 C. elegans cgef-1(gk261) X; itIs153. Show Description
itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. Maintain at 24 degrees; sick at 25 C, GFP lost at 20C. itIs153 is an integrated derivitive of axEx1094. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
WHR7 C. elegans unc-119(ed3) ruIs38 III. Show Description
ruIs38 [myo-2p(partial)::GFP + unc-119(+)] III. Derived by out-crossing AZ218 eleven times to N2.
WHY10 C. elegans glh-1(how3[3xHA::TurboID::glh-1]) I. Show Description
3xHA::TurboID tag inserted at the N-terminus of the endogenous GLH-1. TurboID::GLH-1 promiscuously labels proteins at 20C. Transgene generated in N2 background. Reference: Price I, et al. ELife. 2021 Nov 3;10:e72276. doi: 10.7554/eLife.72276.
WOP122 C.elegans ahcy?1(syb646[ahcy?1::GFP]) I. Show Description
GFP tag inserted at C-terminus of endogenous ahcy-1 locus. Derived by out-crossing parental strain PHX646 two times to N2. Reference: Thapa P, et al. NPJ Aging. 2023 Dec 5;9(1):27. doi: 10.1038/s41514-023-00125-1. PMID: 38052822.
WOP159 C.elegans ahcy?1(syb784 *syb646[ahcy?1(Y145C)::GFP]) I. Show Description
Engineered Y145C substitution mutation in endogenously GFP-tagged ahcy-1 locus. ahcy-1(Y145C) mutation mimics the pathogenic human mutation AHCY Y143C. ahcy-1(Y145C) mutants have a prolonged lifespan and are larger than control animals. ahcy-1(Y145C) mutants are fertile and produce a brood of laid and hatched eggs similar to control animals. ahcy-1(Y145C) mutants show a slight increase in SAH and a decrease in SAM levels, leading to an increased SAH to SAM ratio. See WOP122 for control strain. Derived by out-crossing parental strain PHX784 two times to N2. Reference: Thapa P, et al. NPJ Aging. 2023 Dec 5;9(1):27. doi: 10.1038/s41514-023-00125-1. PMID: 38052822.
XA4900 C. elegans rib-2(qa4900)/qC1 [dpy-19(e1259) glp-1(q339) III. Show Description
Heterozygotes are WT and segregate WT and Sterile Dpys. Homozygous rib-2(qa4900) animals give homozygous F2 animals that can develop to the adult stage but exhibit abnormal phenotypes such as egg-laying defects, increased body width, and reduced activity in movement. While the F2 qa4900 homozygotes are fertile, the F3 qa4900 homozygous progeny stop developing during gastrulation and fail to develop normally. 511 bp deletion in the region of intron2 to exon 6 of the rib-2 gene (K01G5.6).
XA8400 C. elegans qaIs8400. Show Description
qaIs8400 [let-858p::Ov-GST-3 + rol-6(su1006)]. Called AK1 in the reference article. The Ov-GST-3 gene was amplified from genomic DNA of O. volvulus with 1µM of the sequence specific primer 5'Klon and 3'Klon (5'Klon: 5'-GGCGTACGATGTCAAGATTTCCTCAACAAG-3'; 3'Klon: 5'-GGTCTAGATTTATTTAGGAATGATTGAATCGGTCG-3'; representing bases 4 - 25 and the complementary sequence of bases 821 - 841 of the published Ov-GST-3 cDNA (AF203814); bold underlines indicate restriction sites for Pfl23II (SplI) and XbaI, respectively; dotted underline indicates the start codon for translation; italics indicates the conserved sequence for the polyadenylation signal for transgenic transcript processing; the 8 5'-nucleotides of primer 3'Klon and the fourteen 5'-nucleotides of primer 5'Klon do not correspond to the template and introduce the sequences to the amplicon), 200 µM of each deoxynucleotide (Gibco BRL) and 2.5 units of Taq polymerase (Gibco BRL). After an initial denaturation of 3 minutes at 93°C, 35 cycles of annealing at 55°C for 1 minute, synthesis at 72°C for 2 minutes and a 1 minute denaturation at 93°C were performed, followed by a final extension at 72°C for 5 minutes. The genomic Ov-GST-3 fragment obtained by PCR (see above) was ligated into the pGEM-T Easy vector (Promega) by TA-cloning, cleaved with the restriction enzymes Pfl23II (SplI) and XbaI (restriction sites introduced by the primer) and inserted between the unique Pfl23II (SplI) and XbaI sites of the vector pPD103.05 (kindly provided by A. Fire). The sequence of the genomic Ov-GST-3 fragment in the resulting plasmid pAK1 was confirmed by automated dye terminator, dideoxy sequencing (ABI Prism 377TM Sequencer, PE Applied Biosystems) using the PCR primers (see above). The pAK1 DNA was injected in combination with the marker plasmid pRF4 [rol-6(su1006)] into the gonads of N2 C. elegans at a concentration of approximately 100 ng/µl for each plasmid. Transgenic worms were identified by the selectable Roller marker phenotype and the stable transmitting line AK1ex (AK1 extrachromosomal) was established. Integration of the extrachromosomal arrays was achieved by irradiation of AK1ex worms with 3600 rad (1 rad = 0.01 Gy) of x-rays (x-ray chamber: RUM 9421-070-77002, Philips, Netherlands; dosimeter: PTW-SN4, PTW, Germany). The progeny of these worms was then screened for 100% transmittance of the Roller phenotype to obtain the C. elegans line AK1int (AK1 integrated) with the chromosomally integrated transgenes.
ZM6686 C. elegans hpIs289. Show Description
hpIs289 [nca-2p::nca-2::GFP + lin-15(+)]. Rescuing NCA-2::GFP transgene. Originally inserted into nca-2 unc-77 lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
ZM6725 C. elegans hpIs290. Show Description
hpIs290 [nca-1p::nca-1::GFP + lin-15(+)]. Rescuing NCA-1::GFP transgene. Originally inserted into nca-2; unc-77; lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
ZM7055 C. elegans hpEx2999. Show Description
hpEx2999 [ins-4::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP-tagged INS-4::GFP expression driven by its own promoter and UTR. GFP expression in ASI, ASJ, some motor neurons, and punctate expression along dorsal cord as well. Generated in N2 background. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60. PMID: 23665919
ZM7696 C. elegans hpIs376. Show Description
hpIs376 [unc-25p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of D-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM7798 C. elegans hpIs372. Show Description
hpIs372 [acr-5p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM8607 C. elegans hpIs481. Show Description
hpIs481 [ceh-12p::tomm20::miniSOG::SL2::BFP + unc-129(DB)p::tomm20::miniSOG::SL2::BFP + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. unc-129(DB)p is a fragment of the unc-129 promoter driving expression in only DB motor neurons (described in Colavita et al., Science 1998 31;281(5377):706-9). The ceh-12 promoter drives expression in VB motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9062 C. elegans hpIs583. Show Description
hpIs583 [acr-2(s)p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of A- and B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. acr-2s(p) is a 1.8 kb fragment of the acr-2 promoter driving expression in only A- and B- class motor neurons (described in Jospin et al, 2009 PLoS Biol. Dec;7(12):e1000265). Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9123 C. elegans hpIs590. Show Description
hpIs590 [ttr-39p::tomm20::miniSOG::SL2::BFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of D-class motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
AC257 C. elegans ppk-3(n2668) X. Show Description
Growth retardation, enlarged vacuoles (late endosomes and lysosomes) in intestine, epidermis, coelomocytes and pharynx. 27% embryonic lethality and 8% post-embryonic lethality.
AY159 C. elegans gtl-2(n2618) IV; acEx159. Show Description
acEx159 [gtl-2p::gtl-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed primarily in the excretory cell and pharynx). gtl-2 expression driven by gtl-2 promoter. Transgene rescues gtl-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935
AY160 C. elegans gtl-2(n2618) IV; acEx160. Show Description
acEx160 [sulp-4p::gtl-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed in the excretory cell). gtl-2 expression driven by sulp-4 promoter. Transgene rescues gtl-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935