More Fields
Strain Species Genotype
RG3022 C. elegans sra-21(ve522[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1748 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagagcagaaaccacacatctgctcacaga ; Right flanking sequence: tctggactgttattgaaagttttacgggtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3023 C. elegans sra-30(ve523[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctgaaacagtaaattattaactaacCTGAA ; Right flanking sequence: TGAATTCATTGCCTCGAGAATTCCAGAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3024 C. elegans sra-38(ve524[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1918 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATAGCAATGATGAAAACATTAGTGGCATA ; Right flanking sequence: GGTGGTGATAGAGAAGTCCGTTTGACTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3025 C. elegans sra-25(ve525[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1944 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTGTGTTTGGTGAATTCCGTTTTCCACCA ; Right flanking sequence: atgacaatttctggatttttgggtacatct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3026 C. elegans sra-7(ve526[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1486 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tttcacagtccgttgacttttgatgcaatt ; Right flanking sequence: ACAGGATTCGTTCTTCACATGTTAGCCGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3027 C. elegans C40H5.2(ve527[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccaggcaatgatcaacgATGTACGCCTTAT ; Right flanking sequence: TCTGGAAGATCTTGAAGACTCTGCCATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3028 C. elegans C40H5.7(ve528[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT ; Right flanking sequence: atcacatgtcatatacagtattccattaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3029 C. elegans C34C6.3(ve529[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1562 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aatgattttcagttcagATGCCTTCCTCTG ; Right flanking sequence: TATGGAACACAACAAGATGGTAGATCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3030 C. elegans C46F4.3(ve530[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 794 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG ; Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3031 C. elegans F53C11.9(ve531[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 349 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattctcattgagaacatttcaacacacaa ; Right flanking sequence: CAAGGATTTGTTGTTGATTCAAATACCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3032 C. elegans igeg-1(ve532[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2773 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTTGGTCTTTCGATCCAATAACGTTGAA ; Right flanking sequence: AACGGAACATCAGATTCAAAACTGCTCGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3033 C. elegans igeg-2(ve533[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTTAATAGTTGTCGTCGAGTACTTGGAGT ; Right flanking sequence: TGTGGTTCCCGTGTGTGTTCCTTcttaaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3034 C. elegans +/nT1[umnIs49] IV; C37C3.7(ve534[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, Mig. Deletion of 1217 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste Mig GFP+ non-mKate2 (ve534 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GAAGTCGATGCCGTTCTGCAGTATCCTTCA ; Right flanking sequence: TACAATGACAAATCCCTCCAGCATAGATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3035 C. elegans nas-17(ve535[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1433 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATCACTTCGACATGTTTCTTCGACCATCT ; Right flanking sequence: TACGGAAGCAGCAAGTTGACAATTCATTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3036 C. elegans irg-7(ve536[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 5265 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA ; Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3037 C. elegans Y65B4BL.6(ve537[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggctataaaacgacggaaaaagaaataaaa ; Right flanking sequence: ggcggtgaagccgtgtgtgtgtgtgtggct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3039 C. elegans spe-36(ve539[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49] IV; +/nT1 V. Show Description
F40F11.4. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, lays only oocytes. Deletion of 2632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate2 (ve539 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcacaaaaactcacAAATAACTTTGTACCG ; Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAATACATA. sgRNA #1: acAAATAACTTTGTACCGGG; sgRNA #2: CTTCATAGCTCTTGCGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3046 C. elegans C46G7.1(ve546[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 1523 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, larval lethal GFP+ non-mKate2 (ve546 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caatacaatttacaggtaaaagccggcaac ; Right flanking sequence: ATCGGAATTGCAGTTCTTCTTTCACTTCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3047 C. elegans +/mT1[umnIs52] II; K12H4.5(ve547[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous lethal. Deletion of 418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal GFP+ non-mKate2 (ve547 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaattaattaatttataatgtgatcctttt ; Right flanking sequence: agtcgtagacgattttcgattttcactgta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3048 C. elegans M03F4.6(ve548[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC30[ubc-17(tmIs1243)] X. Show Description
tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous lethal. Deletion of 2153 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, arrested GFP+ non-mCherry (ve548 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: TTTGACTTGTTTGTACCCGCATCTACATTG ; Right flanking sequence: ATCGGGAGTTTCTGCACACTGAGTTCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3055 C. elegans rpl-4(ve555[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous lethal, heterozygous animals might grow slower than wild-type. Deletion of 1188 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type mKate2+GFP+, and segregate wild-type mKate2+GFP+, arrested GFP+ non-mKate2 (rpl-4 homozygotes), arrested non-GFP mKate2+ (hT1 homozygotes), and dead eggs. Maintain by picking wild-type mKate2+ and GFP+. Left flanking Sequence: ATTTCTTCACGTTGGCCTTTGAAGCCTTGC ; Right flanking sequence: Ttattacctgcaatcaacagaaatagtaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3061 C. elegans +/mT1[umnIs52] II; algn-11(ve561[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Lvl. Deletion of 2578 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, arrested GFP+ non-mKate2 larvae (ve561 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: cgatcagtttgaaatccataggaaagtttc ; Right flanking sequence: GAATCCAGAATAAAGGCTGAATGGTATAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3065 C. elegans +/nT1 [umnIs49] IV; nol-56(ve565[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Lvl. Deletion of 2013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve574 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs.  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tgcgcaaaactgtacCTTCTCCTTAACCTC ; Right flanking sequence: Tggtgtaagaacctgaaaaatcatttattc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3067 C. elegans +/hT1 [umnIs58] I; erfa-1(ve567[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 2016 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve567 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: cagcacaaatagaatATGAGCGCTCCCGCA ; Right flanking sequence: GGTGGATGTTTCTACTCGCAATTCCAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3069 C. elegans C25H3.14(ve569[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 920 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cgagtactctgtacatgttttgatggtaag ; Right flanking sequence: ACTGGAGTCCACACCAAGGCGTTCCCAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3070 C. elegans C25H3.3(ve570[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1006 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gccgcattttggacccaagatttcgcgtct ; Right flanking sequence: acaatttctaatttgatcgttttgaaaaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3071 C. elegans mlt-2(ve571[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; + /hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous Let. Deletion of 2897 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve571 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: gttttcattaaatcaaaatttgtgccacca ; Right flanking sequence: GCAAACCGTCGATctttaagattgtaacat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3073 C. elegans C25D7.16(ve573[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 323 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGTTCAACAATCGATTGAAATTCGTGTTA ; Right flanking sequence: ACCGGCGTTCAGACAGTCTCCACAAAGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3074 C. elegans +/nT1 [umnIs49] IV; mcm-3(ve574[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste. Deletion of 2846 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate adults (ve574 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tagtacaataggcaatgtaaaatcaatgtg ; Right flanking sequence: cggggaaaatagaaaaattcggcccaaatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3075 C. elegans C25E10.16(ve575[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1085 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: taaggtagcaccatcgaaaaaaaacctcat ; Right flanking sequence: tgtgggttggtatggagaattggagacgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3076 C. elegans anat-1(ve576[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 9928 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtctctttctattttaccttctttccggca ; Right flanking sequence: tgtcccaatttcacattattatatattttg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3077 C. elegans +/mT1[umnIs52] II; bcas-2(ve577[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 944 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Pvul GFP+ non-mKate2 adults (ve577 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaatccaaaaTCAGTTCTCCTGATCCTCTT ; Right flanking sequence: GTAAGTGCTAACGGTTTGGAGCTCATcacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3078 C. elegans +/szT1 [lon-2(e678) umnIs61] I; bcat-1(ve578[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. Show Description
umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Homozygous Let. Deletion of 2704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve578 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttaacacccgtatcattatcatttccatgc ; Right flanking sequence: cccaacttccttccaccccctcaaaaagcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3079 C. elegans bmy-1(ve579[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mIn1[dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Mel. Deletion of 694 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 that give dead progeny (ve579 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ataatgtttcgcaatgctctcctttcctac ; Right flanking sequence: GAAGGACAGAGCTTTGACGGACCTGCGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3080 C. elegans cchl-1(ve580[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mIn1[dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 1136 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve580 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ttattaggcttatggagcggtgggtaaatt ; Right flanking sequence: cacggaaatgatgaaactagagaaaaaagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3081 C. elegans clx-1(ve581[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2495 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atgggaatgttgtggaactttgaatctatg ; Right flanking sequence: gtttttcgccattttgattcgggttcgact. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3082 C. elegans cope-1(ve582[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1274 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaagtccgcaatattacattgcgcgtgaag ; Right flanking sequence: CATGGGTTATCGATTTCAATGAGAAGGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3083 C. elegans copz-1(ve583[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Emb. Deletion of 898 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead eggs (ve579 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atcggctcgtaaatctacacgaaaacctag ; Right flanking sequence: CACAAATCGGCTTCTCGTTCATGAAATCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3085 C. elegans mrpl-34(ve585[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve585 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: ttatcaaactctcatttttagATGCCATCG ; Right flanking sequence: GTCGGCGACGGAATATATTCTTCAAAATCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3086 C. elegans +/hT1 [umnIs58] I; cmd-1(ve586[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 1416 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve586 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gattttttctctctcgtcaccgtttcaccc ; Right flanking sequence: acctgtaaaaccccataaaaaaatttaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3087 C. elegans dad-1(ve587[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; + /hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 699 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve587 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gtgtaacacagcaagagaaacgaaacccca ; Right flanking sequence: TTTGGTAGTCATCGAACAGTTTCGAGAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3088 C. elegans ddp-1(ve588[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygotes have small broods that never mature. Deletion of 401 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 have small broods that never mature (ve588 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatctatagtttttctcacaggaaATGGA; Right flanking sequence: ttaggctcttttccataaattttcccttaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3089 C. elegans dgtr-1(ve589[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 1566 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate that give dead eggs (ve589 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gaactacggtcaaaatcgttgcgagaccct ; Right flanking sequence: GACACTCATCTCATCTTCCAGTGActtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3090 C. elegans dhps-1(ve590[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Ste. Deletion of 4636 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+, Sterile GFP+ non-mKate2 (ve566 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttttcagaaacttgctccaaaATGAGCAC ; Right flanking sequence: agGAGTCGTAAAACACCACATCAACAACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3091 C. elegans +/nT1 [umnIs49] IV; dlst-1(ve591[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1803 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate larvae (ve591 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaattaaaaattttgtgaaagcatgaccaa ; Right flanking sequence: TCTGGAAAGAAACCGATGAACTGATACTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3092 C. elegans hoe-1(ve592[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest with occassional escapers. Deletion of 3396 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate larvae with occasional escapers (ve592 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaaagtaacaatgaactaaaaacgtgaata ; Right flanking sequence: TTGATTGTCGCAGATTTGAGATGCTTGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3093 C. elegans +/nT1[umnIs49] IV; eif-2Bdelta(ve593[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 4255 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve593 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: taccattacttctcatgtatgtacccgccg ; Right flanking sequence: gccctctaactgtttctttttgttctgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3094 C. elegans +/mT1[umnIs52] II; F10E9.5(ve594[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate2 larvae (ve594 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny.  Left flanking Sequence: AGCAACATACAGATGCATCACGTCAAGgta ; Right flanking sequence: CTCTGGCCTAATATTCCATTCAGATTTTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3095 C. elegans F17H10.1(ve595[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 4865 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcactctgtccgcgtttctttgaccgcat ; Right flanking sequence: tagcctcgtaatgtagcagatacccaaaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3096 C. elegans F18A1.7(ve596[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1089 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acatatttgtgtcgggtgattatttacaat ; Right flanking sequence: aggtcatataaggaaaagaacagctaggta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.