More Fields
Strain Species Genotype
KR1787 C. elegans unc-13(e51) I. Show Description
The origin of this strain is KR1082 via CB51. KR1082 was maintained on plates for a period of approximately two years. After this time, DNA was made and the Tc1 pattern examined. The number of Tc1s found in KR1787 was greater than that found in KR1082. Perhaps as many as 30 additional Tc1s were visible in excess of those normally seen in N2 strains.
KR314 C. elegans Show Description
WT var. Kitsilano. Interfertile with N2. See WBG 8(3) 78. Caenorhabditis elegans wild isolate (Tc1 pattern XII).
KRA437 C. elegans unc-3(n3435) X; kasEx147. Show Description
kasEx147 [oig-1p(1.6kb)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 1.6kb cis-regulatory region (-2.6-1.0kb) upstream of oig-1 was fused to GFP with the unc-54 3'UTR. oig-1 uses mulitple cis-regulatory regions to achieve different expression patterns in motor neurons; this construct drives expression specifically in cholinergic motor neurons. Construct was injected into N2 worms. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
LC105 C. elegans unc-46(e177) dpy-11(e224) uIs69 V. Show Description
uIs69 [(pCFJ90) myo-2p::mCherry + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Dpy, Unc. Maintain 15-20 degrees. [NOTE: uIs69 is closely linked and maps to the right of dpy-11. (C. Loer 08/2011)] Derived from (BC277 x N2 Male) x TU3401. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
LC108 C. elegans uIs69 V. Show Description
uIs69 [(pCFJ90) myo-2p::mCherry + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. Maintain 15-20 degrees. [NOTE: uIs69 is closely linked and maps to the right of dpy-11. (C. Loer 08/2011)] Derived from (unc-46(e177) uIs69) x N2 Male. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
LC141 C. elegans him-8(e1489) IV; cat-4(e3015) V. Show Description
Reduction in serotonin and dopamine, most apparent in young larva; bleach hypersensitivity and cuticle fragility in adult, but less than null mutants. Derived by outcrossing CB7107 six times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.
LC143 C. elegans pcbd-1(tm5924) I. Show Description
Slight reduction in serotonin and dopamine, most apparent in L1 larva. Derived by outcrossing FX5924 four times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.
LC144 C. elegans agmo-1(e3016) III. Show Description
General chemical hypersensitivity (including bleach), fragile cuticle. Derived by outcrossing CB7014 five times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.
LC80 C. elegans ptps-1(tm1984) I. Show Description
Serotonin- and dopamine-deficient, tetrahydrobiopterin-deficient, general chemical hypersensitivity, cuticle fragility (rapid disintegration in alkaline bleach), male turning defective (phenotypes appear identical to cat-4 null mutants). Derived by outcrossing FX1984 five times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.
LC81 C. elegans cat-4(tm773) V. Show Description
Serotonin and dopamine-deficient, bleach hypersensitive, general chemical hypersensitivity, fragile cuticle. 652 bp deletion removes entire first exon. Derived by outcrossing FX773 five times to N2.
LC87 C. elegans qdpr-1(tm2337) III. Show Description
Slight reduction in serotonin and dopamine, most apparent in L1 larva. Derived by outcrossing FX2337 two times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.
LC90 C. elegans qdpr-1(tm2373) III. Show Description
Slight reduction in serotonin and dopamine, most apparent in L1 larva. Derived by outcrossing FX2373 two times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.
LP262 C. elegans cpEx25. Show Description
cpEx25 [mrck-1(delta CRIB)::YPet + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. YPet-tagged MRCK-1 truncated upstream of the CRIB domain to inhibit binding to CDC-42. Generated in N2 background. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
MAH23 C. elegans rrf-1(pk1417) I. Show Description
pk1417 outcrossed 4 times to N2. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.
MDX44 C. elegans cylc-2(mon2[cylc-2::mNG::3xFLAG) I. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
MG152 C. elegans xsIs3 I. Show Description
N2 with integrated array pJH4.52. xsIs3[hisH2B::GFP; rol-6(su1006)]. 39.9.1 Must be kept at 25C to avoid germline-silencing.
MG155 C. elegans xsIs4 IV. Show Description
xsIs4 [hisH2B::GFP + rol-6(su1006)]. N2 with integrated complex-array pJH4.52. Must be kept at 25C to avoid germline-silencing.
MJF1 C. elegans chpIR1 (M, CB4856 > N2). Show Description
Reduced lifespan and reduced mitochondrial membrane potential. Transmitochondrial cybrid worm strain was bred to be homoplasmic for the CB4856 mtDNA genome in the N2 nuclear background. Reference: Dingley SD, et al. J Mol Biol. 2014 May 29;426(11):2199-216.
MLC237 C. elegans mir-791(luc39) X. Show Description
luc39 is a deletion of mir-791. mir-791(luc39) mutants show a decreased turning and reversal rate compared to N2 animals under conditions where the CO2 concentration is gradually increased from 0-5%. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
MLC610 C. elegans cah-3(luc28[3' UTRmutant, delta mir-791 binding sites]) Show Description
luc28 removes mir-791 binding sites in the cah-3 3'UTR. luc28 worms show less response towards a gradual increase in CO2 concentration from 0-5% as compared to N2 animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
MLC657 C.elegans akap-1(luc37) III. Show Description
luc37 removes mir-791 binding sites in the akap-1 3'UTR. luc37 worms show less response towards a gradual increase in CO2 concentration from 0-5% as compared to N2 animals, similar to the response of mir-791(lf) animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
MT8190 C. elegans lin-15Bb&lin-15A(n765) nIs51 X. Show Description
nIs51 [egl-10(+) + lin-15(+)] X. Egl-C, Bor, hyperforaging, hyperactive locomotion, and male longevity and mating reduced. By Western blotting and staining the EGL-10 protein is highly overexpressed relative to N2. nIs51 was generated by injecting the lin-15 rescuing plasmid pEK1 at 50 ug/ml and the egl-10 rescuing fragment pMK21 at 80 ug/ml into MT1642 lin-15(n765) worms. The resulting strain was gamma irradiated and an integrant isolated, and was backcrossed to N2 four times. nIs51 was mapped to the right arm of X.
N2 C. elegans C. elegans wild isolate. Show Description
C. elegans var Bristol. Generation time is about 3 days. Brood size is about 350. Also CGC reference 257. Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966. Subcultured by Don Riddle in 1973. Caenorhabditis elegans wild isolate. DR subclone of CB original (Tc1 pattern I). [NOTE: This stock might carry a ~1.8 kb deletion in alh-2 in the background. (UPDATE: 03/26/2018 - a user reported the stock they received was homozygous for the alh-2(ot588) mutation.)]
N2 (ancestral) C. elegans C. elegans wild type (anCestral). Show Description
WT C. elegans. From Cambridge collection-originally frozen around 1968: In 1980, in order to establish an ancestral stock, Jonathan Hodgkin thawed one of the earliest frozen tubes of N2, dating from 1968. From this plate J.H. grew up a population en masse (without subculturing) on NGM plates (about 2 generations). Multiple samples of this were frozen in order to provide a reference N2 stock. This set of stock samples was replenished by regrowth in 1985 and 1991, using the same procedure, and a freshly thawed sample was sent to the CGC in 1993. Thus, samples from this frozen stock, called N2 (ancestral), should be only about 6 generations away from the stock used by Sydney Brenner as his standard WT N2. [Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydner Brenner ca. 1966.] Caenorhabditis elegans wild isolate. Note: N2 (ancestral) has reduced lifespan and fertility relative to the standard CGC N2 strains. See Worm Breeder's Gazette 16(5): 24 (February 1,2001).
N2 Male C. elegans C. elegans wild isolate. Show Description
C. elegans var Bristol. Self-fertilizing hermaphrodite. Generation time is about 3.5 days at 20C. Male stock maintained by mating. Also CGC reference 257. Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966. Subcultured by Don Riddle in 1973. Caenorhabditis elegans wild isolate. DR subclone of CB original (Tc1 pattern I). [NOTE: (09/07/2018) The Gems Lab has identified a mutation in the gene fln-2 carried in this stock causing an increased lifespan. The effect is quite modest (+11%, median lifespan), but this effect can be more pronounced in other genetic backgrounds.] [NOTE: (03/26/2018) - a user reported the stock they received was homozygous wild-type for alh-2; some N2 stocks carry the ot588 mutation in alh-2.)
NB240 C. elegans hsr-9(ok759) I. Show Description
Reduced apoptosis after gamma-ray treatment compared to N2. Reference: Ryu JS, et al; PLoS One. (In Press).
NB353 C. elegans hsr-9(ttTi14815) I. Show Description
Reduced apoptosis after gamma-ray treatment compared to N2. Reference: Ryu JS, et al; PLoS One. (In Press).
NB390 C. elegans hsr-9(ok759) I; brc-1(tm1145) III. Show Description
Reduced apoptosis after gamma-ray treatment compared to N2. Double mutant exhibits hypersensitivity to gamma rays similar to brc-1(tm1145) alone. Reference: Ryu JS, et al; PLoS One. (In Press).
NLS1 C. elegans cdc-7(knu709) I. Show Description
CRISPR-engineered deletion removing entire cdc-7 gene. Out-crossed 3x to N2. Reference: Currey HN & Liachko NF. 2019. A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects. microPublication Biology. Jan 3;2019:10.17912.
NY7 C. elegans flp-1(yn2) IV. Show Description
Loopy, uncoordinated movement. Hyperactive. Nose touch-insensitive. Osm.
OH15205 C. elegans otEx7057. Show Description
Pick TagRFP+ animals to maintain. otEx7057 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Injected into N2. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
PD1074 C. elegans C. elegans wild isolate. Show Description
A defined and recently cloned population of animals derived from the original “Bristol” variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenner’s original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. PD1074 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. PD1074 is intended to be used as a wild type reference strain with the closely matched genome assembly of Yoshimura, et al. (Genome Res. 2019 Jun;29(6):1009-1022) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). We note that PD1074 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in PD1074. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura, et al, (2019).
PE327 C. elegans glp-4(bn2) I; feIs5 X. Show Description
feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. Temperature-sensitive sterile. Maintain at 15C. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
PE328 C. elegans glp-4(bn2) I; feIs4 V. Show Description
feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. Temperature-sensitive sterile. Maintain at 15C. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
PG-1 Unknown species Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
PG-2 Unknown species Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
PG-3 Unknown species Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
PHX5791 C. elegans pop-1(syb5791[GFP::AID::GGGGSGSGS linker::pop-1]) I. Show Description
GFP and AID tags inserted at the N-terminus of the endogenous pop-1 locus by CRISPR. Insertion includes a GGGGSGSGS linker sequence between the tags and POP-1. Generated in N2 background.
PS4997 C. elegans unc-119(e2498) III; syIs179. Show Description
syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PY1463 C. elegans oyEx45. Show Description
oyEx45 [nhr-82::GFP + coelomocyte::GFP]. N2 line injected. Maintain by picking GFP+.
PY1466 C. elegans oyEx38. Show Description
oyEx38 [nhr-77::GFP, coelomocyte::GFP]. N2 line injected. Maintain by picking GFP+.
QG1 C. elegans qgIR1 (X, CB4856>N2) X. Show Description
qgIR1 (X, CB4856>N2, haw102573 to 4,822,488) X. The strain is a nearly isogenic line that carries the CB4856 version of npr-1 in an otherwise N2 genetic background. NIL derived from RIAIL QX58 linked then unlinked to mec-2 from CB3273 lon-2 mec-2, then backcrossed to lon-2 for 12 generations selecting nonLon worms, then homozygosed. Genotyped N2 at pkP6106 and pkP6145. Based on QG613 sequencing, interval is from X:4,754,307-4,864,273.
QV224 C. elegans dvIs19 III; skn-1(zj15) IV. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.
QV225 C. elegans skn-1(zj15) IV. Show Description
Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.
QX1409 C. elegans qqIR7 (I: peel-1(qq99), EG4348>N2); ttTi5605 II; unc-119(ed3) III. Show Description
Nonsense allele of peel-1 carried in Utah isolate EG4348 crossed into N2 Bristol background. Reference: Seidel HS et al. PLoS Biol. 2011 Jul;9(7):e1001115.
RB1284 C. elegans C30F12.6(ok1381) I. Show Description
C30F12.6 Homozygous. Outer Left Sequence: gtataacacaagcctccgcc. Outer Right Sequence: ggagttccagccattgatgt. Inner Left Sequence: ttttcggtctctaaccacgg. Inner Right Sequence: ttggttcaaagctgttgctg. Inner Primer PCR Length: 3260. Estimated Deletion Size: about 2200 bp. Breakpoint data provided by Neline Kriek 10/2004: TTCTTTGTAAATAACTTTTTACTTTACGTTTTTGAAAACATTCTCGATCTCCAAATCTT CbreakpointATTGGTAATTAAAATCAATAATTTCGATTCAGTGTGATCCCACTTAAA TTTTATACATTG. [NOTE: (March 2019) The Moerman lab confirms that diagnostic PCR with one primer internal to the deletion and one external yields the expected product from N2 and no product from RB1284. Primer sequences (5'->3') were ttttcggtctctaaccacgg and gaaacaagcccactcactac.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3000 C. elegans sra-34(ve500[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3001 C. elegans sra-36(ve501[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acggcatttactcacagaaaatgggaatat ; Right flanking sequence: cgcttcaaagtttgtaatttgaaatttgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3002 C. elegans sra-1(ve502[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3003 C. elegans sra-3(ve503[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cagcgtgagaaaaatatcagaatgtgatcg ; Right flanking sequence: gtgggagattctatcaagagaattcactga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.