mir-250 pre-miRNA deletion strain deletion allele in which mir-250 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-61&mir-250 pre-miRNA deletion strain deletion allele in which mir-61&mir-250 pre-miRNAs were replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

umnIs2 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] V. Derived by insertion of tdTomato transgene into parental strain N2 using CRISPR/Cas9.

mir-792 pre-miRNA deletion strain deletion allele in which mir-792 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-785 pre-miRNA deletion strain deletion allele in which mir-785 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-392 pre-miRNA deletion strain deletion allele in which mir-392 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-57 pre-miRNA deletion strain deletion allele in which mir-57 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-248 pre-miRNA deletion allele in which mir-248 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-356 pre-miRNA deletion strain deletion allele in which mir-356 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-1821 pre-miRNA deletion allele in which mir-1821 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-359 pre-miRNA deletion allele in which mir-359 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-1021 pre-miRNA deletion allele in which mir-1021 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-1022 pre-miRNA deletion allele in which mir-1022 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-1824 pre-miRNA deletion allele in which mir-1824 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-800 pre-miRNA deletion allele in which mir-800 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-1818 pre-miRNA deletion allele in which mir-1818 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-47 pre-miRNA deletion allele in which mir-47 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-81 pre-miRNA deletion allele in which mir-81 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

umnIs4 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] III. Derived by insertion of tdTomato transgene into parental strain N2 using CRISPR/Cas9.

mir-1829.3 pre-miRNA & F39B1.3 deletion allele in which mir-1829.3 pre-miRNA & F39B1.3 was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-1829.2 pre-miRNA deletion allele in which mir-1829.2 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

mir-4812 pre-miRNA deletion allele in which mir-1824 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

umnIs7 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs11 [myo-2p::GFP + NeoR, V:1005689 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs13 [myo-2p::GFP + NeoR, X: 6745526 (intergenic)] X. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs16 [myo-2p::GFP + NeoR, X:15420938 (intergenic)] X. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs20 [myo-2p::GFP + NeoR, III:518034 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs27 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs44 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

umnIs47 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] III. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs48 [myo-2p::mKate2 + NeoR, V:1005689 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

umnIs53 [myo-2p::GFP + NeoR, V:18120303 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs59 [myo-2p::mKate2 + NeoR, I:6284001(intergenic)] I. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs62 [myo-2p::mKate2 + NeoR, III:8856215 (intergenic)] III. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs63 [myo-2p::GFP + NeoR, II:11755713 (intergenic)] II. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs65 [myo-2p::mKate2 + NeoR, V:4308261 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

umnIs66 [myo-2p::GFP + NeoR, II:12833878 (intergenic)] II. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs72 [myo-2p::GFP + NeoR, I:6284001 (intergenic)] I. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs74 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] X. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

umnIs76 [myo-2p::GFP + NeoR, V:4308261 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

rjSi1 [cra-1p::cra-1::GFP::cra-1 3'UTR + Cbr-unc-119(+)] II. Single copy insertion. cra-1 promoter, cra-1::GFP and 3'UTR was cloned into pCFJ150 (ttTi5605) vector and inserted into ttTi5605 of EG4322 strain. Outcrossed three times to N2 Bristol; could still carry unc-119(ed9) in the background. Superficially wild-type. This CRA-1::GFP fusion construct has been shown to be functional and its localization reflects endogenous CRA-1 localization. rjSi1 transgene can rescue synapsis defects of cra-1 mutants and restore cross-over events (six bivalents instead of the 11 to 12 univalents characteristic of cra-1 mutants). Brood size and embryonic lethality were significantly, albeit not completely, restored in the rescued line suggesting that the GFP tag might affect other CRA-1 functions. Reference: Gao J, et al. PLOS Genetics 11(3): e1005029. https://doi.org/10.1371/journal.pgen.1005029

kyIR9 [X: ~4745910 - ~4927296, N2>CB4856] X. LG X contains N2 from ~4745910 - ~4927296; the rest is from CB4856. QX9 was crossed to CB4856; a recombinant F2 with N2 npr-1 and CB4856 tyra-3 was isolated. Its progeny was back-crossed to CB4856 8 times, picking npr-1 hets each round prior to homozygosing.

Derived by outcrossing VC224 four times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.