Heterozygotes are WT and GFP+ and segregate Dpy GFP+ and slow-growing, GFP- iff-2 homozygotes.

Segregates GFP+ glowing heterozygotes and non-glowing sterile iff-1 homozygotes. tm483 is a UV/TMP-induced iff-1 deletion allele generated by K. Gengyo-Ando and S. Mitani. hT2[qIs48] homozygotes inviable. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm498) is homozygous sterile.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm499) is homozygous sterile.

peIs1090 [sra-6p::ChR2Y2]. ChR2 expression in ASH neuron. Reference: Yamada K, et al. 2012 Jul;2(7):741-51. PMID: 22870397

Chemotaxis abnormality, developmental delay, small brood size.  pe420 is a 22 bp deletion in exon 1.

peIs422 [gcy-5p::Downward DAG2(worm) + gcy-5p::mCherry + unc-122p::mCherry]. Transgene allows imaging of changes in the amount of diacylglycerol (DAG) in ASER neuron. Reference: Ohno H, et al. Cell Rep. 2017 Sep 5;20(10):2294-2303. PMID: 28877465

peEx2513 [ceh36p::DownwardDAG2(worm) + unc-122p::mCherry]. The diacylglycerol reporter, DownwardDAG2, is expressed in AFD.

peEx2514 [gcy-8p::DownwardDAG2(codon-optimized) + unc-122p::mCherry]. The diacylglycerol reporter, DownwardDAG2, is expressed in AFD.

daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047

Defective in enteric muscle contraction (expulsion) step of defecation motor program and egg-laying (severe bloating-Egl Type A: serotonin and imipramine resistant). Enteric and egg-laying muscle structures are normal. Semi-dominant for Egl defect, but not for constipation defect. n2372/+ : ME3. ES3: adult heterozygotes and homozygotes.

Defective in enteric muscle contraction (expulsion) step of defecation motor program and egg-laying (severe bloating- Egl Type A). Enteric and egg-laying muscle birefringence normal. Semi-dominant: n2373/+ is moderately Egl but not constipated. ME3 : n2373/+. ES3: adult homozygotes. ES2: heterozygotes.

huIs33 [sod-3::GFP + rol-6(su1006)]. Pick Rollers to maintain.

pka not-3. Loss of function allele. Defective in response to nose touch but not to osmotic repellents.

rnyEx133 [opt-2p:::opt-2(aa1-412)::GFP) + pha-1(+)]. Maintain at 25C to select for animal carrying the array. Labels apical intestinal membrane. Reference: Nehrke (2003) 278(45):44657-66.

rnyEx6 [nhx-2p::pHluorin + pha-1(+)]. Maintain at 20-25C to select for array. KWN26 strain expresses the pH-sensitive GFP variant pHluorin throughout the cytoplasm of intestinal cells. Dual excitation ratio imaging (ex. 410/470, em. 435-nm) can be used to measure intestinal pH and intestinal pHluorin fluorescence is observable under standard GFP filter sets. References: J Biol Chem 278:44657-44666. Curr Biol. 18: 297-302. Am J Physiol Cell Physiol. 297:C1071-81. Am J Physiol Cell Physiol.302 C1045-1054.

bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Resistant to germ cell apoptosis. No apoptosing germ cells are decorated by CED-1::GFP in the gonad. ced-3 deletion confirmed by genomic triple primer PCR with 5’-AGTTCACCGTGACAGCGTCTCTTC-3’, 5’-CGATTACGACTTGAACTGTATCCGA-3’, and 5’-TCTTGTGTAAACGAGATTTGCAATG-3’. Homozygous ced-3(n2452) yields only 1,110 bp product. Outcrossed heterozygotes yield both 1,411 bp (wild type ced-3) and 1,110 bp products. [NOTE: (11-05-2019) A user has reported this strain exhibits temperature-sensitive sterility when raised at 25C.]

SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.

nIs106 [lin-11::GFP + lin-15(+)] X. Egl, Him. lin-11::GFP expressed in vulva, head neurons, VC neurons. n3376 enhances ced-3(n2427). Reference: (2007) Genetics 175(4)::1719-33.

SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.

SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.

SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.

Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.

Weak Rubberband.

Vulvaless. 41% die as L1 or early L2.

Chemotaxis defective.

n2031 homozygotes are dead. n2031/dpy-20 unc-22 animals are Vul (27%) or WT (73%).

Lethal suppressor of lin-15(n765).

Unc. n2018 is cold sensitive. Most animals at 15C are Vul/Let. AT 25C, 25% of the animals are non-Vul.

Unengulfed cell corpses.

Cell corpses unengulfed.

Persistent cell corpses. Maternal effect. Recessive.

Vulvaless.

Heterozygotes are WT and segregate WT, Vuls (bags) and DpyUncs. n2030: Vul; impenetrant Mel (rod-like larval-lethal).

Vul. Strong loss of function allele.

Defective chemotaxis to some volatile odorants: benzaldehyde, diacetyl,2,4,5-trimethyl thiazole. Chemotaxis defect is temperature sensitive.

Non-Lethal allele of let-60. Clear. Suppresses n765. Maintain at 15C.

Weak Rubberband.

Heterozygotes are WT and segregate WT, Uncs and DpySte. n2161 is an intragenic revertant of ced-9(n1950). The unc-69 ced-9 homozygotes have a maternal effect lethal phenotype: their offspring arrest as embryos or L1; they also give very few eggs at 25C.

Soc. Maintain under normal conditions. Reference: DeVore DL, Development. 2003 Aug;130(16):3757-66.

Soc. Maintain under normal conditions. Reference: DeVore DL, Development. 2003 Aug;130(16):3757-66.

Con, Sup, Dec (temperature-sensitive). Reference: Mol Bio Cell (2005) 16:1355-65.

Heterozygotes are Unc and segregate Unc, Vul and dead eggs.

Weak defects in protection and killing.

Suppresses clr-1(e1745) at 25 degrees. Reference: (1992) Nature 356:340-4.