JN214 |
C. elegans |
iff-2(tm393)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT and GFP+ and segregate Dpy GFP+ and slow-growing, GFP- iff-2 homozygotes.
|
|
JN215 |
C. elegans |
iff-1(tm483) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates GFP+ glowing heterozygotes and non-glowing sterile iff-1 homozygotes. tm483 is a UV/TMP-induced iff-1 deletion allele generated by K. Gengyo-Ando and S. Mitani. hT2[qIs48] homozygotes inviable. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
|
|
JN218 |
C. elegans |
asb-1(tm498)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm498) is homozygous sterile.
|
|
JN219 |
C. elegans |
asb-1(tm499)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm499) is homozygous sterile.
|
|
JN2389 |
C. elegans |
lite-1(xu7) X; peIs1090. Show Description
peIs1090 [sra-6p::ChR2Y2]. ChR2 expression in ASH neuron. Reference: Yamada K, et al. 2012 Jul;2(7):741-51. PMID: 22870397
|
|
JN2411 |
C. elegans |
sinh-1(pe420) II. Show Description
Chemotaxis abnormality, developmental delay, small brood size. pe420 is a 22 bp deletion in exon 1.
|
|
JN2512 |
C. elegans |
peIs422. Show Description
peIs422 [gcy-5p::Downward DAG2(worm) + gcy-5p::mCherry + unc-122p::mCherry]. Transgene allows imaging of changes in the amount of diacylglycerol (DAG) in ASER neuron. Reference: Ohno H, et al. Cell Rep. 2017 Sep 5;20(10):2294-2303. PMID: 28877465
|
|
JN2513 |
C. elegans |
peEx2513. Show Description
peEx2513 [ceh36p::DownwardDAG2(worm) + unc-122p::mCherry]. The diacylglycerol reporter, DownwardDAG2, is expressed in AFD.
|
|
JN2514 |
C. elegans |
peEx2514. Show Description
peEx2514 [gcy-8p::DownwardDAG2(codon-optimized) + unc-122p::mCherry]. The diacylglycerol reporter, DownwardDAG2, is expressed in AFD.
|
|
JN2722 |
C. elegans |
daf-2(pe2722) III. Show Description
daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047
|
|
JT6428 |
C. elegans |
exp-3(n2372) V. Show Description
Defective in enteric muscle contraction (expulsion) step of defecation motor program and egg-laying (severe bloating-Egl Type A: serotonin and imipramine resistant). Enteric and egg-laying muscle structures are normal. Semi-dominant for Egl defect, but not for constipation defect. n2372/+ : ME3. ES3: adult heterozygotes and homozygotes.
|
|
JT6932 |
C. elegans |
exp-4(n2373) IV. Show Description
Defective in enteric muscle contraction (expulsion) step of defecation motor program and egg-laying (severe bloating- Egl Type A). Enteric and egg-laying muscle birefringence normal. Semi-dominant: n2373/+ is moderately Egl but not constipated. ME3 : n2373/+. ES3: adult homozygotes. ES2: heterozygotes.
|
|
KN259 |
C. elegans |
huIs33. Show Description
huIs33 [sod-3::GFP + rol-6(su1006)]. Pick Rollers to maintain.
|
|
KP4 |
C. elegans |
glr-1(n2461) III. Show Description
pka not-3. Loss of function allele. Defective in response to nose touch but not to osmotic repellents.
|
|
KWN246 |
C. elegans |
pha-1(e2123) III; rnyEx133. Show Description
rnyEx133 [opt-2p:::opt-2(aa1-412)::GFP) + pha-1(+)]. Maintain at 25C to select for animal carrying the array. Labels apical intestinal membrane. Reference: Nehrke (2003) 278(45):44657-66.
|
|
KWN26 |
C. elegans |
pha-1(e2123) III; rnyEx6. Show Description
rnyEx6 [nhx-2p::pHluorin + pha-1(+)]. Maintain at 20-25C to select for array. KWN26 strain expresses the pH-sensitive GFP variant pHluorin throughout the cytoplasm of intestinal cells. Dual excitation ratio imaging (ex. 410/470, em. 435-nm) can be used to measure intestinal pH and intestinal pHluorin fluorescence is observable under standard GFP filter sets. References: J Biol Chem 278:44657-44666. Curr Biol. 18: 297-302. Am J Physiol Cell Physiol. 297:C1071-81. Am J Physiol Cell Physiol.302 C1045-1054.
|
|
KX84 |
C. elegans |
ced-3(n2452) IV; bcIs39 V. Show Description
bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V. Resistant to germ cell apoptosis. No apoptosing germ cells are decorated by CED-1::GFP in the gonad. ced-3 deletion confirmed by genomic triple primer PCR with 5-AGTTCACCGTGACAGCGTCTCTTC-3, 5-CGATTACGACTTGAACTGTATCCGA-3, and 5-TCTTGTGTAAACGAGATTTGCAATG-3. Homozygous ced-3(n2452) yields only 1,110 bp product. Outcrossed heterozygotes yield both 1,411 bp (wild type ced-3) and 1,110 bp products. [NOTE: (11-05-2019) A user has reported this strain exhibits temperature-sensitive sterility when raised at 25C.]
|
|
MT10591 |
C. elegans |
lin-8(n2731) II. Show Description
SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
MT11090 |
C. elegans |
mcd-1(n3376) II; nIs106 X. Show Description
nIs106 [lin-11::GFP + lin-15(+)] X. Egl, Him. lin-11::GFP expressed in vulva, head neurons, VC neurons. n3376 enhances ced-3(n2427). Reference: (2007) Genetics 175(4)::1719-33.
|
|
MT12835 |
C. elegans |
lin-61(n3809) I; lin-56(n2728) II. Show Description
SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
MT12839 |
C. elegans |
lin-61(n3809) I; lin-8(n2731) II. Show Description
SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
MT12881 |
C. elegans |
lin-61(n3447) I; lin-56(n2728) II. Show Description
SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
MT16530 |
C. elegans |
lin-61(n3447) I; lin-8(n2731) II. Show Description
Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
MT200 |
C. elegans |
unc-93(n200) III. Show Description
Weak Rubberband.
|
|
MT4755 |
C. elegans |
sem-5(n2019) X. Show Description
Vulvaless. 41% die as L1 or early L2.
|
|
MT4810 |
C. elegans |
odr-3(n2046) V. Show Description
Chemotaxis defective.
|
|
MT4828 |
C. elegans |
let-60(n2031)/dpy-20(e1362) unc-22(e66) IV. Show Description
n2031 homozygotes are dead. n2031/dpy-20 unc-22 animals are Vul (27%) or WT (73%).
|
|
MT4866 |
C. elegans |
let-60(n2021) IV. Show Description
Lethal suppressor of lin-15(n765).
|
|
MT4867 |
C. elegans |
unc-5(e53) lin-45(n2018) IV. Show Description
Unc. n2018 is cold sensitive. Most animals at 15C are Vul/Let. AT 25C, 25% of the animals are non-Vul.
|
|
MT4933 |
C. elegans |
ced-1(n2089) I. Show Description
Unengulfed cell corpses.
|
|
MT4962 |
C. elegans |
ced-5(n2002) IV. Show Description
Cell corpses unengulfed.
|
|
MT4970 |
C. elegans |
ced-6(n2095) III. Show Description
Persistent cell corpses. Maternal effect. Recessive.
|
|
MT5101 |
C. elegans |
lin-39(n2110) III. Show Description
Vulvaless.
|
|
MT5222 |
C. elegans |
sem-5(n2030)/unc-10(e102) xol-1(y9) dpy-6(e14) X. Show Description
Heterozygotes are WT and segregate WT, Vuls (bags) and DpyUncs. n2030: Vul; impenetrant Mel (rod-like larval-lethal).
|
|
MT5265 |
C. elegans |
lin-39(n2010) III. Show Description
Vul. Strong loss of function allele.
|
|
MT5300 |
C. elegans |
odr-4(n2144) III. Show Description
Defective chemotaxis to some volatile odorants: benzaldehyde, diacetyl,2,4,5-trimethyl thiazole. Chemotaxis defect is temperature sensitive.
|
|
MT5449 |
C. elegans |
clr-1(e1745) II; let-60(n2021) IV. Show Description
Non-Lethal allele of let-60. Clear. Suppresses n765. Maintain at 15C.
|
|
MT5475 |
C. elegans |
aex-3(n2166) X. Show Description
|
|
MT5519 |
C. elegans |
sup-9(n1550n2174) II; sup-10(n983) X. Show Description
Weak Rubberband.
|
|
MT5523 |
C. elegans |
unc-69(e587) ced-9(n1950n2161)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Uncs and DpySte. n2161 is an intragenic revertant of ced-9(n1950). The unc-69 ced-9 homozygotes have a maternal effect lethal phenotype: their offspring arrest as embryos or L1; they also give very few eggs at 25C.
|
|
MT5554 |
C. elegans |
clr-1(e1745) II; egl-15(n2202) X. Show Description
Soc. Maintain under normal conditions. Reference: DeVore DL, Development. 2003 Aug;130(16):3757-66.
|
|
MT5562 |
C. elegans |
clr-1(e1745) II; egl-15(n2210) X. Show Description
Soc. Maintain under normal conditions. Reference: DeVore DL, Development. 2003 Aug;130(16):3757-66.
|
|
MT5701 |
C. elegans |
flr-4(n2259) X. Show Description
Con, Sup, Dec (temperature-sensitive). Reference: Mol Bio Cell (2005) 16:1355-65.
|
|
MT5748 |
C. elegans |
let-60(n2022) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
|
|
MT5749 |
C. elegans |
let-60(n2034) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, Vul and dead eggs.
|
|
MT5750 |
C. elegans |
let-60(n2035) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
|
|
MT5816 |
C. elegans |
ced-4(n2273) III. Show Description
Weak defects in protection and killing.
|
|
MT5851 |
C. elegans |
ced-4(n2274) III. Show Description
|
|
MT5896 |
C. elegans |
sup-9(n1550) II; unc-93(n2289) sup-18(n1014) III. Show Description
|
|
MT5998 |
C. elegans |
sem-5(n2195) X. Show Description
Suppresses clr-1(e1745) at 25 degrees. Reference: (1992) Nature 356:340-4.
|
|