Homozygous viable. Deletion of 988 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTGAAACATTTTTCAAGTCATGATTCCA; Right flanking sequence: TTTCCGGTAGAAATTTTCACCAACTTCCCG. sgRNA #1: AATTGCCCGGGAATTTCACC; sgRNA #2: GGTGTCGTTGTTTGTCAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1106 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAAGAGATGCTATGACAATCAAGAATAA; Right flanking sequence: ATTTAAGTTTTTTTTATTACAACAAAGTAC. sgRNA #1: ATTAATTCAAAGAAGGGTGG; sgRNA #2: CATCAAATCTCTAGGCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGATTTCGAATCAAATCTTATTTTTTCTTC; Right flanking sequence: TCGTCAAAATGCGTCTCCAAATGTATAAAA. sgRNA #1: TTCTTCTTCGAAACACTCGG; sgRNA #2: ACTCGAGCAATTCAGACTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2297 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTGCCAGAAGCCTATTTTTCGCTTTTCCC; Right flanking sequence: CTGATTACGACCTTTTAATAGCATAACTTG. sgRNA #1: GAAGATGGGACATTACAGAT; sgRNA #2: CTTTGTAGAAGGGATACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATCGGCACAGCTCGATAAGCCTCAAGTGA; Right flanking sequence: GAGCTTTAACCGCAAATTCGTCTGTTGATT. sgRNA #1: TCCGTAGCGTTATCTCCAGT; sgRNA #2: GTGAGCACAATTACCGAGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGAGAAGAAGAACTGCAACTACTACAGGA; Right flanking sequence: AGGGAAAGAGAATTTGGTGTCAGTAGGTGA. sgRNA #1: ATTCCAGTGATTTCTGTGGG; sgRNA #2: ACACAACGCATCAGTATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2424 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTTTCAGAAGAACTGCTTCTGGGAAATGG; Right flanking sequence: GATATTGTTGGTACTCTCCACGAGCTGGAT. sgRNA #1: GATAACCAAAAGTGTCGTGG; sgRNA #2: CATTTCCTTGCAAGCCTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4236 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATAGGAGACGTCCGGATTTGTCGATGGA; Right flanking sequence: CGGTTTTCTGGGATTTCTTCGGGAATTTCT. sgRNA #1: GAATCGTGTACGGTGTGTGG; sgRNA #2: TCTCTTTTCGATTTAATGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATTTTATCCATTTGAGAACGAGATTTGTT; Right flanking sequence: GAAAATTTGTCTTGAATTCTCACAATATCC. sgRNA #1: GTGTAGATACCTCCAGTTGG; sgRNA #2: AGAAATGTCGCATAGATCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCTAAACAGTGCCACTATCCCCATCCG; Right flanking sequence: TGGGCGTTTAATTTGAAAGAATTGAGTAAA. sgRNA #1: TTCTCAAAGGTCCCTTGTGG; sgRNA #2: TTCTTTCAATGGGTGCTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1914 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTTTTCGAATTTTTGAATTTTGTCACCT; Right flanking sequence: AGGATCTCGAGCTTTTGTTTTTTTTTTCAA. sgRNA #1: GAAAAGAGACTTATACAGGC; sgRNA #2: ACATTTCTCAACTCGTCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1885 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAGCACGAATCTACAAACATTTTATTTT; Right flanking sequence: TGGCCCATAATTATGGGGCTCGAGTTGCTC. sgRNA #1: GCAATAGTTCTCAGTTCTCA; sgRNA #2: ACAGAGATTTTACTTCAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1987 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGGGAATTTGTTGTCTATTGCAAATCCA; Right flanking sequence: CGGACCAGTGGTTGCTCCGAGGTTGTTCAC. sgRNA #1: AAGGCTTTATATCCCGGTGG; sgRNA #2: CCGTCAATGGCCAAAGGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1797 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGTAAATTAGAAATATTCTAGTTTTAGG; Right flanking sequence: TGGAAGATGAGCAGAAGTTTGAAGAAGATT. sgRNA #1: TATTGTTCATCGATGATGGC; sgRNA #2: AGTTGTGCCGAAGAATATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3226 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAAATACGAAGACTACGGAAACTACATTAT; Right flanking sequence: AGGTCTTGGATCAACGAATGAATTGGCTTT. sgRNA #1: TTCAGAACTAATGGGCGGAG; sgRNA #2: ACTGCATTCATGACTCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTTCTTGCGCTTAGCACCGCCCATTTTAAA; Right flanking sequence: AGACCCATGCAGAGAAACTGCTTGTGCCTT. sgRNA #1: ATCAATCAGCGAACTTTTGG; sgRNA #2: CTCCACGATCTCAGCTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2010 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACACGGAAACCATACGTTGAAGCCTTTCCA; Right flanking sequence: TGGCAAAGCATCATCACTTATTCCAGAAAT. sgRNA #1: GAAGATGTTGCTTCACTTGG; sgRNA #2: CTTCTTTTAGTCCATCTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4130 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTGCTGCTTCTACTGCCCCCGTGTCCCG; Right flanking sequence: TGGAATAAGACGTGTCAGCTCCATATCTGT. sgRNA #1: CCGTCCAAATCTCACGTCAC; sgRNA #2: AAAGTTTCTACATCCTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced tmC25. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7105 and FX30257. hd7105 is a deletion of 4581 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAATAGCTTACTATTAGCTAGAAAATCCG; Right flanking sequence: GAGCGGCCATATTTAGACAGTTTTTTTGGTTCT. sgRNA #1: GGTTGGAATTGAGGAACGTT; sgRNA #2: TTCGAGCGGAGTCCATGGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1854 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCGGAGACACTACACCTTCGAGACTCCT; Right flanking sequence: TGGTGCTCAATGTGCAGTGGCGTTTGGCTC. sgRNA #1: TCTTCAGTATATCCATTCGG; sgRNA #2: CGACTTGACGCTCATCGACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 900 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAACAGATCTACACAATCCTGGAGCTCCT; Right flanking sequence: AGGCTCATTTTTGAAGCCGAATTTTACTAA. sgRNA #1: CACGAACATCTAGCTCCCTC; sgRNA #2: CTCCACTCGCCAAGGATAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 7162 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTACACCTTCTCTAATGACATTTCCACCG; Right flanking sequence: TATTATCAGCTGCTGATACAGATAAAAGGA. sgRNA #1: AATCCAATGAATGCATCAGC; sgRNA #2: ACTACATCACAGACTGTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3086 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAAGAAGCTTTTCAACCACCCGCCTCCCT; Right flanking sequence: AGGACACATTATGGAGCCACCATACTTCCC. sgRNA #1: GTTATCAATCACACGACTGG; sgRNA #2: CAGGTTGAACTAGTGAATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 14229 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTATAAGGAGCAGAATGTCTTTCCATTGGA; Right flanking sequence: AGGACATGCTTTTCATGCTGAAATCCGACG. sgRNA #1: GCAATTTGACGAGTTTCGGG; sgRNA #2: AAAAGTCAAGATTGGCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 15206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTATGGTAGGTCTTTCAAGCCTGCGTGCCT; Right flanking sequence: CTTTGGGTCACCTTATGAGACATGACCGGT. sgRNA #1: TAGAAAACTAGTCATGAGGG; sgRNA #2: CGCTGAGGGATCAATGTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCGCAGGGAAATGGATTTATGCCCGATGGT; Right flanking sequence: AGGTCCGCAAAACCCCAGGAAAAAAGTCTA. sgRNA #1: TCATCGAGATTCACATGCAA; sgRNA #2: AGCTACTAGAACTTTCTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1516 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TACTTGTACAGTCGAGACTGGCTCACACCA; Right flanking sequence: CTGCAGTTGATGATCAACCCGAGAATGTTC. sgRNA #1: AGAATTGTCAGCATTCCAGC; sgRNA #2: TGGTCAGAATCTCTTCTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 5798 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAGAGGAAGCTGATTAAATTTTCGAAATG; Right flanking sequence: CGACTTTATAAAAGCCGTTGTACCATATTT. sgRNA #1: GGCCACTATGTTATAGTCGG; sgRNA #2: CCATCGTTCTATACTCCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1144 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAATTTACAGTTCACAATCGCGTCACACCC; Right flanking sequence: GGGGACAAGCTGAGCTATGCAGATTATGCT. sgRNA #1: CGAAAATATAATCGGGTTAG; sgRNA #2: ACGGCGAAAACTTTGTGTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGGAGCTCGTCAACGATGAAAATTCTGCCA; Right flanking sequence: ACCTCTTATGCAATTCCAAAACAATTTTCT. sgRNA #1: GGAAACAACTTCAACATGGG; sgRNA #2: GACAGATGGCCTCAGTTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1154 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCATCTTTTATATGCAAATATATTCCT; Right flanking sequence: CGTATGTGAAAGAATATGGAGAGGATCGGG. sgRNA #1: CATTATAAATTGTGGAAGGG; sgRNA #2: ATGCTTCAATCGTTGCTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1165 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCATCAAATTCATTTTTGGATCAATCGGTT; Right flanking sequence: TGGGTTATTCATAAGGTGTGAGTCCCAAAA. sgRNA #1: GTTTTAGGAGCACATCACGG; sgRNA #2: ATCATCACGGCAGACACAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2110 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGCTACATTCAGGGGTGTTTTTTCATATCT; Right flanking sequence: CGGCAATTGTCGCAAAAAATTTGGTGTGAC. sgRNA #1: CAAAGCTATGATGTGGTCCA; sgRNA #2: GCCAGCGTCTGTTAGAGCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 885 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGTTCAAAGGCAAGCACATTGGCGCGGC; Right flanking sequence: TGGAATATATTATTCAAAAACGACAATTGC. sgRNA #1: GACCGCCCGTCTCGAGACAT; sgRNA #2: TTCAGAATGAGTTCAAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1991 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TACGATGGAACCATCACCAGACGGTCAACT; Right flanking sequence: TTTTCTCATTTTTCTCATCGTCGATGCATT. sgRNA #1: CGAGATAATCGCAAATTCAG; sgRNA #2: CCACATATGTTATCAAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3115 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAGTGGACGGTTTTGTGGGCATAATGCAT; Right flanking sequence: CCACTCCCCTTTTTCGGAAATTGGAAAACG. sgRNA #1: CACATTTCACGCACAGAAGA; sgRNA #2: TGAACGAAAGATTAACGGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion balanced with tmC25. Maintain by picking wild-type GFP+. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7151 and FX30257. hd7151 is a deletion of 435 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCCGATAAAGTTGTGACGCCCTTTGCCA; Right flanking sequence: TGTCGATCTTCCTTGTTTTTTGTTGAAAAA. sgRNA #1: AAACTTACTCAGATATGCTC; sgRNA #2: CAAAAACTAGCTAGAAATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAGGCCTCCAGTAGATGCTCCAGGAGCCG; Right flanking sequence: CGGGATGCGATACACGAAAACCTTGGGTTT. sgRNA #1: TGCAGTTTCCCGCCCTCGTC; sgRNA #2: TGACCGCTGGTTCCGATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3555 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAACTGTGGATAGAATTAGGGGTGGACGAA; Right flanking sequence: AATATAGTATTATAGGACCGAAAATATAGA. sgRNA #1: AAACGATTTACTCCGGCTAT; sgRNA #2: CAAAAAATTAGCGTCTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAACTTCTGGACAACCGGCAGAAACGCCA; Right flanking sequence: GTAGGCACAAAGAAGGCGTAGGCCTCCTGG. sgRNA #1: TGGCGTTTCAGAGCTGCACG; sgRNA #2: AAAGCCAATTGTCTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 969 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAGACCTTGAACAATCTTCCATTCGCCA; Right flanking sequence: CGGACATTCTGAAAATTTAGCAATTTACAC. sgRNA #1: TTCCCAGTTACCATCGAGGG; sgRNA #2: GACCAAAACGCGAAGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2415 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACTTTCTCGGAGTTATCCCCTTCGATTT; Right flanking sequence: GGGAGAGGAGTAGGTCCCGGTGGTAAATTT. sgRNA #1: GTCGAGCGATGGAAGACCGG; sgRNA #2: GGAGAGTATTGCCGAACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 911 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAATGTTGAAAATAAAAGTGAAAAACTCT; Right flanking sequence: TGGAATTGGATATTTTTGCCACTTTTAATC. sgRNA #1: GTTGGTGTGGTTTTGCGTGG; sgRNA #2: TTTCTCTCCCGTAAACCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6488 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAAGCCGAGATTACAAAGAATATGATGA; Right flanking sequence: GACCTTTTATAACTATTCACCCATACTAAT. sgRNA #1: AAGACGAGTCGGCACAGTTG; sgRNA #2: GTGAAGTTGTTATTGTACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTAAAAACTTTAATAGATACATTTTTGGC; Right flanking sequence: ATACGCTTCTACAATACAACAATCGTTGAA. sgRNA #1: AAAATTACGCCAAACCTGCT; sgRNA #2: ACATTTGAATTATGTTGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

wyEx915 [hlh-17p::mCherry + unc-122p::GFP]. Low penetrance backwards coiler. This strain was produced by crossing TV2394 with N2 to remove wyIs45.

3xFLAG and eGFP tags inserted into the endogenous hlh-30 locus. Superficially wild-type. Diffuse GFP in basal growing conditions and strong nuclear labeling upon diverse stresses like starvation, Staphylococcus aureus infection, arsenite, diethylmaleate, heat shock or levamisole. GFP expression is only visible at high magnification; not discernible with a fluorescence stereoscope. Insertion can be detected by PCR. Forward primer sequence: 5' acgcacgcaactgcttta; Reverse primer (in 3'UTR): 5' aataacctgcgattctgg; Reverse primer (in eGFP): CTTGAAGAAGATGGTACGCTC. Expected products (For&Rev 3'UTR): 910 bp (WT)/1878 bp (syb1452). Expected products (For&Rev eGFP): no band (WT)/811 bp (syb1452). Insertion allele generated by SunyBiotech and out-crossed twice with VZ Lab N2. Reference: Martina JA, et al. EMBO J. 2021 Feb 1;40(3):e105793

wbmIs81 [eft-3p::3XFLAG::GFP::SKL::unc-54 3'UTR *wbmIs65] (V:8645000). Ubiquitous expression of peroxisome-targeted GFP. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. Derived from parental strain WBM1140 by CRISPR-mediated insertion of peroxisome-targeted GFP downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome (wbmIs65). Outcrossed six times to WBM lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.

pgIR1 (I, CB4856>N2). CB4856 Chromosome I in N2 background.