Lox P sites in 3' UTR and 4th intron flank kinesin motor domain sequences; sup-1(e995) mini-gene inserted in second intron. Appears wild-type on plates and in quantitative locomotion assays. Can be used to conditionally delete gene sequences encoding the conventional kinesin motor domain in a tissue specific manner by driving expression of Cre recombinase in the tissue of interest. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.

cp13[nmy-2::gfp + LoxP] I. GFP inserted into the endogenous nmy-2 gene by Cas9-triggered homologous recombination. Green fluorescence in many tissues, especially the germline. Fluorescence is similar to, but brighter than, the nmy-2::GFP transgene zuIs45. Reference: Dickinson DJ, et al. 2013 Nature Methods Advance Online Publication. DOI: 10.1038/nmeth.2641.

cp21[hmr-1::GFP + LoxP] I. GFP inserted at the C terminus of endogenous hmr-1 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. GFP expression in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

N-terminally tagged GFP::CHE-12. Cilia are slightly shorter than WT. GFP fluorescence appears in multiple sensory cilia in the head and phasmid neuron cilia in the tail. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.

Entire che-12 coding sequence deleted and replaced with GFP. This produced a phenotype that is more penetrant than that reported for the original che-12 strain, which introduced a nonsense mutation midway through the coding region. Short amphid and phasmid cilia. Defective chemotaxis to NaCl. Dye-filing defective. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

cp20[hmp-1::gfp + LoxP] V. GFP inserted at the C terminus of endogenous hmp-1 gene by Cas9-triggered homologous recombination. Green fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

C-terminally tagged CHE-12::GFP. Cilia are slightly shorter than WT. GFP fluorescence appears in multiple sensory cilia in the head and phasmid neuron cilia in the tail. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.

mNG::aPKC endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).

PAR-6::mNG endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).

PAR-6::mKate2 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).

cp65[mrck-1::YPet + LoxP]. YPet inserted at the C terminus of endogenous mrck-1 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. Yellow fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

NMY-2::mKate2 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).

cp78[gfp::hmp-2 + LoxP] III. GFP inserted at the N terminus of endogenous hmp-2 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar in the second synthetic intron of GFP. Green fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

Maintain at 15C. Semi-permissive at 20C. 100% lethal at 25C. cp21[hmr-1::gfp + LoxP] I males were crossed to WM179 nmy-2(ne3409) hermaphrodites. Fluorescence in early embryos, larvae, and adults. Severe cytokinesis defects in early embryos at 25°C. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

cp189[mrck-1::GFP::3xFlag]. GFP inserted at the C terminus of endogenous mrck-1 gene by Cas9-triggered homologous recombination. Floxed selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. GFP expression in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

Superficially wild-type. LoxP sites were inserted into near the 5' and 3' ends of the endogenous unc-70 locus to facilitate conditional or cell-specific knockout of the gene. The 5' loxP site can be detected by PCR using the primers 5' tttattaatctatgatttttcagcaaaa 3' and 5' tgacgataatctcttaaaattttgc 3'. The 3' loxP site can be detected by PCR using the primers 5' acgtactgtcgctgaggttacc 3' and 5' gacgtcgatacaaataattcgtccca 3'. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987

mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirEx131 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Maintain by picking worms with YFP expression in AIB neurons. Blue fluorescence in flp-18 expressing neurons. loxP sites inserrted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. mirEx131 contains calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB and gpa-14p:CRE. CRE under gpa-14 promoter generates a conditional eat-4 KO in ASH (NOT defective) after recombination of loxP sites in that locus and switches BFP expression in AVA to ChR2-HRDC and jRGECO1a after recombination of lox2272 sites. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs47 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Blue fluorescence in flp-18 expressing neurons. loxP sites before first (eat-4(mir12[loxP 5'UTR])) and after second exon (eat-4(mir17[loxP intron2])) of eat-4 gene. Lite. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB. Conditional eat-4 KO in ASH (NOT defective) and ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

loxP sites inserted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. mNeonGreen is inserted at the N-terminus right before a putative proprotein convertase cleavage site and Western analysis indicates most of the mNeonGreen is cut from the MIG-1 protein and is diffuse in the extracellular fluid. See Figure S1 in Keeley et al., Dev Cell. 2020 Jul 6;54(1):60-74.e7. doi: 10.1016/j.devcel.2020.05.022. PMID: 32585132

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mKate. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

CRISPR/Cas9 insertion of mNeonGreen tag into endogneous deb-1 locus. Low penetrance Rup and Pvl. Reference: Park K, et al. eLife. 2023 Jul 5;12:RP87037. doi: 10.7554/eLife.87037. PMID: 37405383.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

CRISPR-engineered deletion of ddr-2. Low penetrance Rup. Reference: Park K, et al. eLife. 2023 Jul 5;12:RP87037. doi: 10.7554/eLife.87037. PMID: 37405383.

Superficially wild-type. mNG tag inserted into the endogenous fgt-1 locus. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. Specifically tags the long isoform of mig-6. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.