More Fields
Strain Species Genotype
NM5322 C. elegans jsSi1570 I; bqSi711 IV. Show Description
jsSi1570 [delta_mosL::loxP::rpl-28::FRT::GFP::his-58::FRT3::mosR] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chromosome I. Derivative of jsTi1453 lacking the left mos1 arm.
NM5402 C. elegans jsSi1579 II; bqSi711 IV. Show Description
jsSi1579 [loxP::rpl-28p::FRT::GFP::his-58 FRT3] II. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.
NM5471 C. elegans jsSi1669 IV. Show Description
jsSi1669 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3’ rpl-28p::FRT::GFP::his-58::FRT3] IV. Single component RMCE landing site on Chr IV adjacent to the site of the commonly used ttTi10882 MosSCi insertion site.
NM5500 C. elegans jsSi1691 II. Show Description
jsSi1691 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3' rpl-28p::FRT::GFP::his-58::FRT3] II. Single component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.
NM5548 C. elegans jsSi1726 II. Show Description
jsSi1726 [loxP myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] II. Single component rapid RMCE landing site on Chromosome II adjacent to ttTi5605. Created from jsSi1579 (and jsSi1706) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
NM5549 C. elegans jsSi1727 I. Show Description
jsSi1727 [mosL::loxP::myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3::mosR] I. Single component rapid RMCE landing site on Chromosome I at jsTi1453. Created from jsTi1453 (and jsSi1710) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
NM5738 C. elegans jsSi1815 V. Show Description
jsSi1815 [loxP::mex-5p::FLP::sl2::mNeonGreen + rpl-28p::FRT::GFP::his-58 3' FRT3] V. Single component RMCE landing site on Chromosome V adjacent to oxTi365. Created using CRISPR/cas9 with SEC selection and heat shock excision. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
NM5753 C. elegans jsSi1837 IV. Show Description
jsSi1837 [loxP::mec-4Sp::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] IV. Single component rapid RMCE landing site on Chromosome IV adjacent to cxTi10882. Created from jsSi1669 (and jsIs1824) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
NM5879 C. elegans jsSi1900 II. Show Description
jsSi1900 [loxP::cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5922 C. elegans jsSi1944 II. Show Description
jsSi1944 [loxP::mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5934 C. elegans jsSi1962 I. Show Description
jsSi1962 [mosL::loxP::FRT + myo-2p::nls::CyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5937 C. elegans jsSi1971 I. Show Description
jsSi1971 [mosL::loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5938 C. elegans jsSi1978 V. Show Description
jsSi1978 [loxP::FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5943 C. elegans jsSi1986 IV. Show Description
jsSi1986 [loxP + myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP::D5 glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5944 C. elegans jsSi1987 V. Show Description
jsSi1987 [loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5945 C. elegans jsSi1988 IV. Show Description
jsSi1988 [loxP + cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5946 C. elegans jsSi1985 V. Show Description
jsSi1985 [loxP + myo-2p::FRT::nls::CyOFP myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5953 C. elegans jsSi1949 II; him-8(e1489) IV. Show Description
jsSi1949 [loxP + myo-2p::FRT::nls::mNG myo-2 3' + <{rps-0p HygR unc-54 3'} ori <{Amp} <{mex-5p nls-Cre tbb-2 3'} + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5970 C. elegans jsSi1973 I; him-8(e1489) IV. Show Description
jsSi1973 [mosL + loxP + myo-2p::FRT::nls::mNG::myo-2 3' + <{rps-0p::HygR::unc-54 3'} + ori <{Amp} <{mex-5p::nls::Cre::tbb-2 3'} + FRT3 + mosR] I. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5989 C. elegans jsSi1963 IV. Show Description
jsSi1963 [loxP + FRT::myo-2p::nls::CyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM6007 C. elegans jsSi1901 II. Show Description
jsSi1901 [loxP + FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM6024 C. elegans jsSi2029 IV. Show Description
jsSi2029 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + mex-5p::nls::Cre::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM6037 C. elegans jsSi2049 V. Show Description
jsSi2049 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} mex-5p::nls::Cre::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM6168 C. elegans jsSi2027 II; him-8(e1489) IV. Show Description
jsSi2027 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} + mex-5p::nls::Cre::glh-2 3' + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
OD2174 C. elegans unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V). Show Description
CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD2359 C. elegans fzy-1(lt20::loxP)/mIn1[mIs14 dpy-10(e128)] II. Show Description
CRISPR/Cas9 engineered deletion of fzy-1 in which the fzy-1 coding sequence was replaced by LoxP. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate wild-type dim GFP (heterozygotes), Dpy bright GFP (mIn1 homozygotes), and non-GFP fzy-1 homozygotes (larval arrest). Pick wild-type with dim GFP and check for correct segregation of progeny to maintain. gRNA sequence: Ggacgcacgcccggtagtgc Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
OD2425 C. elegans plk-1(lt18[plk-1::sGFP]::loxp) III. Show Description
GFP inserted at the C terminus of plk-1 followed by LoxP generated by Cre-mediated excision of unc-119(+) cassette. Reference: Martino L. et al. Dev Cell. 2017 Oct. 23; 43(2):157-171.
OD2906 C. elegans mdf-1(lt39[mNG::tev::loxP::3xFlag::mdf-1]) V. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous mdf-1 locus using CRISPR/Cas9 engineering. gRNA sequence: tgattgcattaaacatatt Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
OD2909 C. elegans san-1(lt42[gfp::tev::loxP::3xFlag::san-1]) I. Show Description
GFP tag inserted at 5' end of endogenous sep-1 locus using CRISPR/Cas9 engineering. gRNA sequence: taaaataatatgtataaac
OD3913 C. elegans cyb-1(lt125[cyb-1::LAP::mNG::loxP::3xFlag]) IV. Show Description
mNeonGreen and Flag tags inserted at 3' end of endogenous cyb-1 locus using CRISPR/Cas9 engineering. gRNA sequence: atgcgtccacttttgcattc Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD4087 C. elegans cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD4376 C. elegans mdf-1(lt167[mScarlet::tev::loxP::3xFlag::mdf-1])V. Show Description
CRISPR/Cas9 engineered. Tagged MDF-1 at its endogenous locus with mScarlet. gRNA sequence: tgattgcattaaacatatt Reference: Lara-Gonzalez P, et al. Science. 2021 Jan 1;371(6524):64-67. doi: 10.1126/science.abc1424. PMID: 33384372.
OH15876 C. elegans pha-4(ot946[pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous pha-4 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Please contact Oliver Hobert prior to publishing work using this strain.
OH17918 C. elegans lep-5(ot1215[lep-5p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the lep-5 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. Males exhibit typical leptoderan tails.
OH17921 C. elegans linc-3(ot1217[linc-3p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) V. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-3 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers.
OH17923 C. elegans linc-19(ot1219[linc-19p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) III. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-19 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers.
OH17929 C. elegans linc-23(ot1225[linc-23p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) I. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad.
OH17932 C. elegans linc-26(ot1227[linc-26p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad and extremely dim expression in hermaphrodite spermatheca.
OH17935 C. elegans linc-36(ot1229[linc-36p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-36 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the sperm of both hermaphrodites and males.
OH17938 C. elegans linc-41(ot1231[linc-41p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-41 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad, spermatheca of hermaphrodites, as well as several other tissues in the head.
OH17942 C. elegans tts-1(ot1234[tts-1p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the tts-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in several tissues including the pharynx but is significantly upregulated in a stress-dependent manner in a variety of tissues.
OH17945 C. elegans puf-9(ot1236[puf-9::GFP::loxP::3xFLAG]) X. Show Description
SEC cassette was used to generate a C-terminal GFP tag of puf-9. Expression is cytoplasmic and pan-somatic throughout larval development into adults.
OH18019 C. elegans linc-1(ot1249[linc-1p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) I. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad.
PHX2880 C. elegans ceh-16(syb2709[loxP] syb2880[ceh-16::loxP::GFP]) III. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-16 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX2934 C. elegans ceh-37(syb2933[loxP]) ceh-36(syb2934[ceh36::loxP::GFP]) X. Show Description
CRISPR/Cas9 engineered tagged endogneous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX3426 C. elegans ceh-27(syb2714[loxP] syb3286[loxP] syb3426[ceh27::GFP]) V. Show Description
CRISPR/Cas9 engineered tagged endogneous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX5755 C. elegans pha-4(ot946 ot1078 syb5755[pha-4::3xGAS::GFP::3xGAS::AID::TEV::LoxP::3xFLAG]) V. Show Description
Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.
PX624 C. elegans fxSi1 I; spe-44(fx123[spe-44::degron]) IV; fog-2(fx111) V. Show Description
fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. Degron tag was inserted into the endogenous spe-44 locus in the JU2526 wild isolate background, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Reference: Kasimatis, KR et al. (2020) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605
PX631 C. elegans fxSi3 I; fxSi4 II; fog-2(q71) V. Show Description
fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605
PX658 C. elegans fxSi1 I; fxSi4 II; fxSi6 III; spe-44(fx123[spe-44::degron]) IV; fog-2(fx111) V. Show Description
fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605