jsSi1815 [loxP::mex-5p::FLP::sl2::mNeonGreen + rpl-28p::FRT::GFP::his-58 3' FRT3] V. Single component RMCE landing site on Chromosome V adjacent to oxTi365. Created using CRISPR/cas9 with SEC selection and heat shock excision. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.

jsSi1837 [loxP::mec-4Sp::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] IV. Single component rapid RMCE landing site on Chromosome IV adjacent to cxTi10882. Created from jsSi1669 (and jsIs1824) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.

jsSi1900 [loxP::cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1944 [loxP::mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1962 [mosL::loxP::FRT + myo-2p::nls::CyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1971 [mosL::loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1978 [loxP::FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1986 [loxP + myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP::D5 glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1987 [loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1988 [loxP + cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1985 [loxP + myo-2p::FRT::nls::CyOFP myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1949 [loxP + myo-2p::FRT::nls::mNG myo-2 3' + <{rps-0p HygR unc-54 3'} ori <{Amp} <{mex-5p nls-Cre tbb-2 3'} + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1973 [mosL + loxP + myo-2p::FRT::nls::mNG::myo-2 3' + <{rps-0p::HygR::unc-54 3'} + ori <{Amp} <{mex-5p::nls::Cre::tbb-2 3'} + FRT3 + mosR] I. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1963 [loxP + FRT::myo-2p::nls::CyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi1901 [loxP + FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi2029 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + mex-5p::nls::Cre::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi2049 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} mex-5p::nls::Cre::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

jsSi2027 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} + mex-5p::nls::Cre::glh-2 3' + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207

CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

CRISPR/Cas9 engineered deletion of fzy-1 in which the fzy-1 coding sequence was replaced by LoxP. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate wild-type dim GFP (heterozygotes), Dpy bright GFP (mIn1 homozygotes), and non-GFP fzy-1 homozygotes (larval arrest). Pick wild-type with dim GFP and check for correct segregation of progeny to maintain. gRNA sequence: Ggacgcacgcccggtagtgc Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.

GFP inserted at the C terminus of plk-1 followed by LoxP generated by Cre-mediated excision of unc-119(+) cassette. Reference: Martino L. et al. Dev Cell. 2017 Oct. 23; 43(2):157-171.

mNeonGreen and Flag tags inserted at 5' end of endogenous mdf-1 locus using CRISPR/Cas9 engineering. gRNA sequence: tgattgcattaaacatatt Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.

GFP tag inserted at 5' end of endogenous sep-1 locus using CRISPR/Cas9 engineering. gRNA sequence: taaaataatatgtataaac

mNeonGreen and Flag tags inserted at 3' end of endogenous cyb-1 locus using CRISPR/Cas9 engineering. gRNA sequence: atgcgtccacttttgcattc Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

CRISPR/Cas9 engineered. Tagged MDF-1 at its endogenous locus with mScarlet. gRNA sequence: tgattgcattaaacatatt Reference: Lara-Gonzalez P, et al. Science. 2021 Jan 1;371(6524):64-67. doi: 10.1126/science.abc1424. PMID: 33384372.

GFP tag inserted at the C-terminus of the endogenous pha-4 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Please contact Oliver Hobert prior to publishing work using this strain.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the lep-5 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. Males exhibit typical leptoderan tails.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-3 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-19 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad and extremely dim expression in hermaphrodite spermatheca.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-36 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the sperm of both hermaphrodites and males.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-41 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad, spermatheca of hermaphrodites, as well as several other tissues in the head.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the tts-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in several tissues including the pharynx but is significantly upregulated in a stress-dependent manner in a variety of tissues.

SEC cassette was used to generate a C-terminal GFP tag of puf-9. Expression is cytoplasmic and pan-somatic throughout larval development into adults.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad.

GFP tag inserted at the C-terminus of the endogenous ceh-16 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

CRISPR/Cas9 engineered tagged endogneous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

CRISPR/Cas9 engineered tagged endogneous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. Degron tag was inserted into the endogenous spe-44 locus in the JU2526 wild isolate background, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Reference: Kasimatis, KR et al. (2020) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxIs10 [synthetic guide site::(delta)HygR::unc-54 3' UTR::LoxP, II:8420157]. fxIs10 is a CRISPR-engineered site for future transgene insertion via CRISPR utilizing a synthetic guide site (GGACAGTCCTGCCGAGGTGGAGG?) with a split hygromycin resistance selection marker; fxIs10 also introduced a small deletion of genomic sequence at the insertion site (II:8420158-8420207). Reference: Stevenson ZC, et al. G3 (Bethesda). 2020 Oct 5;10(10):3775-3782. doi: 10.1534/g3.120.401400. PMID: 32816924

fxIs47 [rps-0p::5’ (delta)HygR::GCGAAGTGACGGTAGACCGT::3’ (delta)HygR::unc-54 3’::LoxP, II:8420157]. Phenotypically wild-type strain carrying a landing pad for barcode integrations. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acggcatttactcacagaaaatgggaatat ; Right flanking sequence: cgcttcaaagtttgtaatttgaaatttgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cagcgtgagaaaaatatcagaatgtgatcg ; Right flanking sequence: gtgggagattctatcaagagaattcactga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.