More Fields
Strain Species Genotype
RB2142 C. elegans K09C4.1(ok2855) X. Show Description
K09C4.1. Homozygous. Outer Left Sequence: TTAGCCACTTCCTTCCAAGC. Outer Right Sequence: AAGCTGATTGAATGATGCCC. Inner Left Sequence: TTCTTGGAATACAAAGCCCG. Inner Right Sequence: CAACTGACCTGTCCAACTGC. Inner Primer PCR Length: 1253 bp. Deletion Size: 1070 bp. Deletion left flank: GTAAATTTCAATTTATGGAATTTCAACAAT. Deletion right flank: AAACTCAATAAGAGTGTTGTTTGTTACAGA. Insertion Sequence: GTTTGTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4158 C. elegans AH9.1(gk5243) K09C4.10(gk5244) X. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5243 mutation is C->T, flanking sequences TTCAGTCCGACTGTTTTGTGATGGCTGTCT and CAGAACCAATTACGTTTGTCAATTTTCCGC. The gk5244 mutation is C->A, flanking sequences TGTCTGATCCTTTCTCAATAGTTCCATCCT and GCGCTTTTCAGCAATATGATTTTCAGATCC.