enIs59 [ced-1p::2xFYVE::GFP + unc-76(+)] I. ced-1p::2xFYVE::GFP is a phosphainositol PtdIns(3)P reporter expressed in engulfing cells for assaying cell corpse clearance and other membrane trafficking events. GFP expression from enIs59 is relatively low and causes the least deleterious effects to worm development. Reference: Lu N, et al. PLoS Biol. 2012 Jan;10(1):e1001245. PMID: 22272187

Recessive Unc. Recessive apoptotic cell removal defect. Recessive phagosome maturation defect (inefficient and prolonged phagosome maturation process in embryos). Reference: Mangahas PM, Yu X, and Zhou Z. J Cell Biol. 2008 Jan 28;180(2):357-73.

hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4081 [rig-3p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre + myo-2p::RFP]. Pick RFP+ (pharynx) to maintain. Transgenic animals are GFP and RFP positive in multiple neurons in the head, but strong RFP signals in AVA neurite. Superficially wild type. Activation of gtACR2 decreases AVA and AVB’s calcium signals. hpEx4081 can be maintained by picking animals with weak pharyngeal RFP signals (seems to be a common artifact of the Cre-LoxP system).

hpIs824 [flp-18p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA soma and neurites of the VNC. Activation of gtACR2 inhibits both forward and backward movement.

hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4292 [pdf-1p::LoxP::eBFP::LoxP::gtACR2::Cherry + twk-40p(short)::Cre + lin-15(+)]. Pick non-Muv to maintain. Red and green fluorescence in multiple head neurons. Activation of gtACR2 reduces AVB signals but does not generate specific changes in AVA.

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4340 [nmr-1p::TeTx::wCherry + sra-11p::TeTx::wCherry + HygromycinR]. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Transgenic animals are severely Unc. RFP positive head neuron soma can be observed under V16 in older animals. Hygromycin can be used to select for hpEx4340 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40p(short)::Cre + myo-2p::wCherry]. hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. RFP positive in AVA soma and neurite along the VNC. Weak pharyngeal RFP. Flat and slow movement without ATR or LED stimulation. Chrimson activation induces loopy reversal but not loopy forward after 5min.

oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.

hpIs179 [sra-11p::D3cpv]. 2.8 kb sra-11 promoter sequence drives Cameleon (a genetically-induced calcium indicator) in AVB, AIA, and AIY head interneurons. Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.

hpIs270 [rig-3p::FRT::stop::FRT::ChR2(H134R)::wCherry + nmr-1p::FLP + lin-15(+)]. ChR2 activation in AVA neurons upon exposure to blue light (470 nm). Slightly slow growth. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035

hpEx2999 [ins-4::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP-tagged INS-4::GFP expression driven by its own promoter and UTR. GFP expression in ASI, ASJ, some motor neurons, and punctate expression along dorsal cord as well. Generated in N2 background. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60. PMID: 23665919

Temperature-sensitive Daf-c. Maintain at 15C. hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. Development. 2014 Apr;141(8):1767-79.

Stiff backing. Presumptive null. This strain carries two CRISPR-engineered deletions to ensure complete knockout of ubr-1 function. hp821 is a deletion in the 5 ' end of ubr-1 and hp833 is a deletion near the 3' end of the gene. Reference: Chiturri J, et al. PLoS Genet. 2018 Apr 12;14(4):e1007303. doi: 10.1371/journal.pgen.1007303. eCollection 2018 Apr. PMID: 29649217.

hp684(Q1864X) mutant animals generate reversal movement with little flexing of the posterior body, and the stiffness is prominent during prolonged reversals. This phenotype is progressive, and most prominent when animals develop from the L4 stage larvae into adults. Reference: Chitturi JH, et al. PLoS Genetics. 2018;14(4):e1007303.

hpIs481 [ceh-12p::tomm20::miniSOG::SL2::BFP + unc-129(DB)p::tomm20::miniSOG::SL2::BFP + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. unc-129(DB)p is a fragment of the unc-129 promoter driving expression in only DB motor neurons (described in Colavita et al., Science 1998 31;281(5377):706-9). The ceh-12 promoter drives expression in VB motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.

hpEx3371 [rgef-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.

Sluggish, flat, slightly sterile. Derived by out-crossing parental strain VC1957. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782

hpEx2905 [myo-2p::RFP + myo-3p::daf-2]. Pick RFP+ to maintain. Maintain at 15C. Temperature sensitive dauer constitutive. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.

Hyperactive. Frequent alternation between forward and backward locomotion (shuttling). hp647 is a is a gain-of-function mutation identified as a suppressor of the 'fainter' motor defects of unc-80(e1069) mutants. Reference: Gao S, Elife. 2018 Jan 23:7:e29915. doi: 10.7554/eLife.29915. PMID: 29360035.

hpIs583 [acr-2(s)p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of A- and B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. acr-2s(p) is a 1.8 kb fragment of the acr-2 promoter driving expression in only A- and B- class motor neurons (described in Jospin et al, 2009 PLoS Biol. Dec;7(12):e1000265). Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.

hpIs636 [rig-3p::HisCl1::SL2::mCherry]. mCherry expression in AVA soma and neurites along VNC. Non-specific mCherry expression in gut. HisCl activation leads to reduced forward and reversal activity.

hpEx3370 [dpy-30p::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic strain expressing DAF-16A isoform from pan-tissue dpy-30 promoter. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.

hpEx3508 [ges-1p::daf-16a,d&f + myo-2p::RFP]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. ges-1 promoter drives expression DAF-16A,D&F transgene in intestine. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.

hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. D motor neuron activation and muscle relaxation upon illumination with green light. Muscle activity measured by GCaMP3. Reference: Lu Y, et al. 2022. Current Biology (In Press).

zxIs6 [unc-17p::ChR2::YFP + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Cholinergic activation. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs675 [rgef-1p::GCaMP6s::3xNLS::mNeptune + lin-15(+)]. Worms express GCaMP6s and mNeptune in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446

hpIs673 [rgef-1p::Chrimson::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. All neurons are marked with red fluorescence. Pan-neuronal activation and muscle contraction upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs673 [rgef-1p::Chrimson::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. All neurons are marked with red fluorescence. Pan-neuronal activation and muscle contraction upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).

Four amino-acid residues (G24–V27) near the N-terminus of EGO-1 were replaced with a PA-tag sequence (GVAMPGAEDDVV derived from human podoplanin) in the endogenous ego-1 gene. The PA-tag insertion can be checked by PCR with the following primers: TTCAAAATGCCGCTGCCTTC and GTCCTCTTCGCATCTTTATCAG, followed by digestion with Sau96I. The wild-type ego-1 gene contains a Sau96I site within its PCR region, while the PA-tagged ego-1 does not. This strain was used for immunofluorescence analysis of EGO-1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Maintain at 20C or lower. The met-2 set-25 double mutant exhibits partial sterility and no significant defects in chromosome segregation. MET-2 and SET-25 are the methyltransferases responsible for histone H3K9me2 and H3K9me3. The deletion mutations can be checked by PCR with the following primers: met-2(ok2307), GGTTGATGCGGAGAAGACTG and AATGGATTCGGTGCTTCGTG; set-25(n5021), GAGCCCGTGCCACAGAGTAG and CCTAGAGCGATGTCCTTGATGG. This strain was used as a negative control in the immunodetection of H3K9me2.

zxIs127 [sng-1p::SNG-1::CRY2olig(535) + myo-2p::mCherry]. Strain should be kept in the dark; it is very light-sensitive. Pan-neuronal expression of a truncated variant of Arabidopsis thaliana Cryptochrome-2 fused to synaptogyrin. If illuminated with blue light, synaptic vesicles cluster, resulting in inhibition of synaptic transmission. Synaptic transmission is restored within 15 minutes in the absence of light (ca. 6.5min time constant), resulting in normal wild type behavior afterwards. Reference: Vettkotter D, et al. Nat Commun 13, 7827 (2022). https://doi.org/10.1038/s41467-022-35324-z. PMID: 36535932

Pseudowild levamisole resistance. Head more resistant than body. Body resistance is temperature sensitive. WT phenotype.

Recessive. Resistant to levamisole. Weakly to moderately temperature sensitive. WT movement.

Recessive. Levamisole resistant. WT movement. Weakly to moderately temperature sensitive.