Search Strains

Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc mre-11 homozygotes, and dead eggs (nT1 homozygotes). mre-11 homozygotes produce about 200 fertilized eggs but only about 2-3% of these eggs survive to adulthood (this mutation cannot be maintained in a homozygous condition). Occasionally non-Unc progeny that do not demonstrate the mre-11(ok179) mutant phenotype arise when grown in large liquid cultures. mre-11 is the predicted gene ZC302.1

Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc msh-5 homozygotes, and dead eggs (nT1 homozygotes). msh-5 homozygotes give 97.9% dead eggs; of those that hatch, 42% are male.

Can be maintained by chunking or setting up male/hermaphrodite crosses. Dpy.

Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc spo-11(me44) homozygotes, and dead eggs (nT1 homozygotes). spo-11(me44) homozygotes are viable and produce more than 90% dead eggs (a large fraction of the survivors are males — strong Him phenotype); cytologically they lack chiasmata in diakinesis-stage oocytes and lack RAD-51 foci. Maintain by picking Unc.

meIs1 [pie-1p::GFP::lacI + unc-119(+)]. meIs4 [lac-O + rol-6(su1006) + lacO] IV. Pick Rol worms to maintain. This strain throws both Rol and non-Rol worms, seemingly due to random silencing of rol-6(su1006) in the lacO array, meIs4. The strain expresses GFP::LacI in the gonad and embryos that is observed as foci (of lacO target) and nuclear haze. The expression level of GFP::LacI occasionally becomes low possibly due to random silencing of meIs1. If this happens, heat shock the strain at 25°C for 3 days, and pick a clone that exhibits bright GFP signals. Even at the highest expression level, GFP signal is too weak to detect with a fluorescent dissection microscope, and it is necessary to use a regular compound fluorescent microscope with an oil immersion 60X or 100X objective. The NA of the objective should be higher than 1.4. Reference: Bilgir C, et al. G3 (Bethesda). 2013 Mar 11. pii: g3.112.005165v1.

Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc him-3(me80) homozygotes, and dead eggs (nT1 homozygotes). him-3(me80) homozygotes are viable and non-Unc. They produce more than 85% dead eggs and a large fraction (11%) of the survivors are males (Him phenotype). Cytologically they exhibit a reduced level of HIM-3 loading and fewer stretches of SYP-1 than WT. In diakinesis-stage oocytes, they contain a mixture of bivalents and univalents. Maintain by picking Unc.

Balanced heterozygotes are Unc and segregate Unc (heterozygotes), non-Unc syp-2(ok307) homozygotes, and dead eggs (nT1 homozygotes). syp-2(ok307) homozygotes are viable and non-Unc. They produce 96% dead eggs and 44% males; cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes.

Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc syp-1(me17) homozygotes, and dead eggs (nT1 homozygotes). syp-1(me17) homozygotes produce 95% dead embryos and 38% males. Cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes. qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine.

Dpy. Unc. meT7 is an end-to-end-to-end fusion of chromosomes III, X, and V. The right end of III is fused to the left end of X, and the right end of X is fused to the left end of IV. Constructed by crossing eT5 and mnT12. meT7 homozygotes produce 92% viable progeny. meT7 heterozygotes are Him and produce many dead eggs.

qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP ok197 homozygotes (viable, sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. rad-50 homozygotes are viable, produce more than 95% dead eggs and a large fraction of the survivors are male (Him phenotype). Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Reference: Hayashi M, et al. PLoS Genet. 2007 Nov;3(11):e191.

krIs14 [hsp-16.48p::MosTransposase + lin-15B + unc-122p::GFP]. Heterozygotes are WT with GFP (GFP+ coelomocytes & GFP+ pharynx), and segregate WT GFP, arrested nT1[qIs51] aneuploids, and Dpy Unc homozygotes (GFP+ pharynx & GFP+ coelomocytes). Homozygous nT1[qIs51] inviable. Pick WT with GFP (GFP+ pharynx & GFP+ coelomocytes) and check for correct segregation of progeny to maintain. References: Robert V & Bessereau JL. EMBO J. 2007 Jan 10;26(1):170-83. doi: 10.1038/sj.emboj.7601463. PMID: 17159906. Rosu S, et al. Science. 2011 Dec 2;334(6060):1286-9. doi: 10.1126/science.1212424. PMID: 22144627. Toraason E, et al. Elife. 2024 Aug 8;13:e80687. doi: 10.7554/eLife.80687. PMID: 39115289.

dbEx721 [npr-4::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in the AVA and RIV neurons, possibly in BAG, in the tail neuron PQR, and in the BDU neurons. Expression was also seen in the coelomocytes, the intestine, and the rectal gland cells. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.

Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC) encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases. Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017.

acEx102 [vha-6p::pmk-1::GFP + rol-6(su1006)]. Maintain by picking Rollers. Reference: (2010) J Bio Chem 285(14):10832-40.

zcIs4 [hsp-4::GFP] V. vit-6(ac6) is a dominant allele that causes ER stress. Since vit-6 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.

kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. acEx24 [srbc-48p::srbc-48(cDNA) + unc-122::GFP]. Maintain by picking GFP+ to maintain array. Integrated RFP expression in AWB and AWC. Bright GFP expression in coelomocytes. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971

kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. acEx25 [odr-1p::srbc-48::GFP]. Maintain by picking GFP+ to maintain array. Extra-chromosomal GFP expression in AWC neurons. Integrated RFP expression in AWB and AWC. acEx25 rescues srbc-48 mediated defects. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971

acEx159 [gtl-2p::gtl-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed primarily in the excretory cell and pharynx). gtl-2 expression driven by gtl-2 promoter. Transgene rescues gtl-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935

acEx160 [sulp-4p::gtl-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed in the excretory cell). gtl-2 expression driven by sulp-4 promoter. Transgene rescues gtl-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935

F49F1.6. mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9-engineered ∼1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Derived by out-crossing parental strain PHX1027 (Suny Biotech) with N2 six times. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446

acEx162 [mul-1p::mul-1::SL2::GFP + myo-2p::mCherry]. Pick mCherry+ to maintain. GFP expression in the intestine. acEx162 transgene rescues mul-1(lf). mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9 ∼1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446

acEx187 [vha-6p::nhr-8::SL2::GFP + rol-6(su1006)]. Pick Rollers to maintain (GFP expression in intestine is easy to see and might be easier to score than Rol). Intestinal rescue of nhr-8(ok186) mutants. Reference: Otarigho B & Aballay A. 2020. iScience. 2020 May 22;23(5):101068. doi: 10.1016/j.isci.2020.101068. PMID: 32361270.

acEx188 [unc-30(+) + myo-2::mCherry]. Pick mCherry+ animals to maintain. Expression of unc-30 driven by its own promoter rescues unc-30(ok613). Reference: Otarigho B & Aballay A. Cell Rep. 2021 May 25;35(8):109187. doi: 10.1016/j.celrep.2021.109187. PMID: 34038721.

acEx189 [rab-3p::unc-30 + myo-2::mCherry]. Pick mCherry+ animals to maintain. Expression of unc-30 driven by rab-3 neuronal promoter rescues unc-30(ok613) in neurons. Reference: Otarigho B & Aballay A. Cell Rep. 2021 May 25;35(8):109187. doi: 10.1016/j.celrep.2021.109187. PMID: 34038721.

Male/hermaphrodite line. Maintain at 15C to insure maintenance of male/hermaphrodite line.

Non-conditional hermaphrodite sterile. Males fertile. Self-progeny produced after mating.

Self-sterile hermaphrodites; fertile males. Mated hermaphrodites produce self and outcross progeny. Self progeny are 33% males.

Deletion allele of F08B4.2. Homologous to Drosophila fat cadherin. Primers HES 114/115 outer and HES 116/117 inner.

Temperature sensitive. Recessive. Feminization.

eEx25 [C13G4(cosmid) + XDM23(phage)]. Animals with eEx25 are WT. Pick wild-type to maintain. Animals which have lost eEx25 are Twitchers and Sterile (occasionally produce young). This cosmid lacks the 3' end of the unc-22 gene while XDM23 lacks the 5' end of unc-22, but following injection an extrachromosomal array was formed that included at least one functional unc-22 gene.

Temperature sensitive. Fertile at 16C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Maintain at 15C. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage. Increase lifespan in males and hermaphrodites.

Temperature sensitive. Partially fertile at 16C (very few progeny). Sterile at 20C and 25C. Weak Dpy at 15C. Spermatogenesis arrests at the spermatocyte stage.

Heterozygotes are WT and segregate wild-type, wild-type heterozygotes, and Sterile Dpy (spe-4 dpy-20 homozygotes). Homozygous mutants are weak Dpy and partially fertile at 15C. Sterile at 20-25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature sensitive. Weak Dpy and partial fertility at 15C (very few progeny). Sterile at 20C and 25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.

Temperature sensitive. Few progeny at 16C. Sterile at 20C and 25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage.

Male/hermaphrodite mating strain. Hermaphrodites self-sterile at all temps, males fertile. Spermatids activate "normally" in TEA. In pronase they produce spikes but never form pseudopods. Similar to spe-12 and spe-8.

Temperature sensitive Dpy. Male/hermaphrodite mating strain. Hermaphrodites self-sterile at all temps; males fertile. Spermatids arrest with spikes in pronase; form normal pseudopods in TEA.

Temperature-sensitive. Fertile and weak Dpy at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.

Male/hermaphrodite mating strain. Hermaphrodites self-sterile at all temps; males fertile.

Homozygous male/hermaphrodite line. Males are fertile. Hermaphrodites are sterile, but slightly leaky producing a few progeny (at 25C - ts not tested). In pronase, spermatids from males activate to form many long spikes, terminating at this stage. A very few (1-3 per worm) activate to form normal-looking, motile spermatozoons.

Hermaphrodites are sterile; Males are fertile. Hermaphrodites lay oocytes (produce a few fertile eggs and many oocytes). Produce viable progeny when mated to males. Hermaphrodites produce 10X more self progeny at 20C (2.5/herm) than at either 16C or 25C.

Temperature sensitive spe-27 allele. Hermaphrodites are sterile at 25C but produce 30-40 progeny/hermaphrodite at 16C. Males are fertile.

Temperature sensitive spe-27 allele. Hermaphrodites sterile at 25C; hermaphrodites produce 30-40 progeny/hermaphrodite at 16C. Males cannot mate due to the unc-22 mutation. Maintain at 15C.

Unc. Leaky sterile at 20C; tighter at 16C and 25C. Easier to propagate as if male-female strain.

Dpy. spe-6(hc163) is a recessive suppressor of spe-27(it132). spe-6(hc163) also suppresses spe-8, spe-12, spe-29 and other spe-27 alleles. Causes precocious spermatid activation. Fertile between 15-25C.