More Fields
Strain Species Genotype
CFJ77 C. elegans kstSi32 I; unc-119(ed3) III. Show Description
kstSi32 [Cbr-unc-119(kst13)] I. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.
CFJ94 C. elegans unc-119(ed3) III; kstSi37 IV. Show Description
kstSi37 [Cbr-unc-119(kst13)] IV. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.
CG289 C. elegans unc-103(n1213) pha-1(e2123) III; him-5(e1490) V;rgEx81. Show Description
rgEx81[pha-1(+) + unc-103 promoter E::unc-103 genomic DNA]. Maintain at 20C.
CG490 C. elegans unc-103(n1213) III; egl-2(rg4) him-5(e1490) V; rgEx173. Show Description
rgEx173 [unc-103ep::egl-2(cDNA) + gtl-1p::CFP]. Pick animals with cyan fluorescence in their intestines. rgEx173 rescues food deprivation's ability to suppress unc-103(n1213)-induced male sex muscle seizures.
CG499 C. elegans daf-2(e1368) unc-103(n1213) III; him-5(e1490) V; rgEx178. Show Description
rgEx178 [lev-11p::daf-2(+) + lev-11p::GFP]. rgEx178 rescues food deprivation suppression of unc-103(n1213)-induced spicule protraction.
CG500 C. elegans daf-2(e1368) unc-103(n1213) III; him-5(e1490) V; rgEx180. Show Description
rgEx180 [aex-3p::daf-2(+) + tnt-4p::GFP]. rgEx180 reduces unc-103(n1213)-induced spicule protraction, and rescues constitutive dauer formation.
CG625 C. elegans unc-103(n1213) pha-1(e2123) III; him-5(e1490) V; rgEx235. Show Description
rgEx235 [plc-3p::YFP + pha-1(+)]. Expresses YFP from a 4.4bk upstream plc-3 promoter. Maintain at 20C.
CG640 C. elegans daf-2(e1368) unc-103(n1213) III; him-5(e1490) V; rgEx247. Show Description
rgEx247 [hsp-16p::daf-2(+) + lev-11p::GFP]. rgEx247 restores food-deprivation suppression of unc-103(n1213)-induced spicule protraction.
CG644 C. elegans pha-1(e2123) III; him-5(e1490) V; rgEx251. Show Description
rgEx251[pha-1(+) + osm-12 promoter:: unc-103(gf)]. Maintain at 20C.
CGC128 C. elegans +/hT2 [umnIs15] I; dcr-1(pk1351)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, dcr-1 homozygotes (protruding vulva, sterile/egl, rupture at vulva), lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Pvul. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived from parental strains CGC26 and NL687. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC132 C. elegans mir-356(umn42[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) III. Show Description
mir-356 pre-miRNA deletion strain deletion allele in which mir-356 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC15 C. elegans umnIs4 III. Show Description
umnIs4 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] III. Derived by insertion of tdTomato transgene into parental strain N2 using CRISPR/Cas9.
CGC16 C. elegans hT2 [umnIs5] I; hT2 [bli-4(e937)] III. Show Description
umnIs5 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] I. Homozygous-viable translocation marked with bli-4 and tdTomato. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Derived by insertion of tdTomato transgene into parental strain KR1234 using CRISPR/Cas9.
CGC17 C. elegans unc-4(e120)/mT1 [umnIs6] II; dpy-17(e164)/mT1 [dpy-10(e128)] III. Show Description
umnIs6 [eft-3p::NLS::tdTomato + HygroR, III:~5753000 (intergenic)] II. Heterozygotes are WT with dim red fluorescence, and segregate WT with dim red fluorescence, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes with more intense red fluorescence), and DpyUnc with no red fluorescence. Pick WT with dim red fluorescence and check for correct segregation of progeny to maintain.
CGC18 C. elegans umnIs7 III. Show Description
umnIs7 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC19 C. elegans eT1 III; eT1 [umnIs8] V. Show Description
umnIs8 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
CGC20 C. elegans dpy-18(e364)/eT1 III; unc-46(e177)/eT1[umnIs9] V. Show Description
umnIs9 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC23 C. elegans dpy-18(e364)/eT1 [umnIs12] III; unc-46(e177)/eT1 V. Show Description
umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC25 C. elegans hT2 [umnIs14] I; hT2 [bli-4(e937)] III. Show Description
umnIs14 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] I. Homozygous viable. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.
CGC26 C. elegans dpy-5(e61)/hT2 [umnIs15] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC31 C. elegans umnIs20 III. Show Description
umnIs20 [myo-2p::GFP + NeoR, III:518034 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC32 C. elegans sC1(s2023) [dpy-1(s2170) umnIs21] III]. Show Description
umnIs21 [myo-2p::GFP + NeoR, III: 518034 (intergenic)]. Dpy GFP+. Derived by insertion of myo-2p::GFP transgene into sC1 balancer in parental strain BC4279 using CRISPR/Cas9.
CGC34 C. elegans eT1 [umnIs12] III; eT1 V. Show Description
umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC38 C. elegans umnIs27 III. Show Description
umnIs27 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC4 C. elegans umnTi1 III. Show Description
umnTi1 [eft-3p::GFP + unc-119(+)]. Integration site: (III:-4.25 cM/ nt 3,771,500). Might still contain unc-119(ed3) in background.
CGC45 C. elegans unc-4(e120)/mT1 [umnIs34] II; mT1 [dpy-10(e128)]/dpy-17(e164) III. Show Description
umnIs34 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
CGC47 C. elegans hT2 I; hT2 [bli-4(e937) umnIs36] III. Show Description
umnIs36 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] III. Homozygous-viable translocation marked with bli-4 and mKate2. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.
CGC49 C. elegans hT2 I; hT2 [bli-4(e937) umnIs38] III. Show Description
umnIs38 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Homozygous-viable translocation marked with bli-4 and GFP. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.
CGC5 C. elegans umnTi2 III. Show Description
umnTi2 [eft-3p::GFP + unc-119(+)]. Integration site: (III:+13.25 cM/nt 11,816,400). Might still contain unc-119(ed3) in background.
CGC51 C. elegans sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Dpy mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain BC4279 using CRISPR/Cas9.
CGC52 C. elegans dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs42] III. Show Description
umnIs42 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate2+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC55 C. elegans eT1 [umnIs45] III; eT1 V. Show Description
umnIs45 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] III. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
CGC57 C. elegans umnIs47 III. Show Description
umnIs47 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] III. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.
CGC60 C. elegans dpy-18(e364)/eT1 III; unc-46(e177)/eT1[umnIs46] V. Show Description
umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type mKate+, and segregate wild-type mKate2+, Unc-36 mKate+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC65 C. elegans mT1/unc-4(e120) II; mT1 [dpy-10(e128) umnIs51]/dpy-17(e164) III. Show Description
umnIs51 [myo-2p::mKate2 + NeoR, III: 11755713 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
CGC66 C. elegans unc-4(e120)/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/dpy-17(e164) III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
CGC68 C. elegans mT1/unc-4(e120) II; mT1 [dpy-10(e128) umnIs54]/dpy-17(e164) III. Show Description
umnIs54 [myo-2p::GFP + NeoR, III: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-mGFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
CGC69 C. elegans dpy-18(e364)/eT1 [umnIs55] III; unc-46(e177)/eT1 V. Show Description
umnIs55 [myo-2p::mKate2 + NeoR, V:1005689 (intergenic)] III. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, Unc-36 mKate+(eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC70 C.elegans eT1 III; eT1 [umnIs56] V. Show Description
umnIs56 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
CGC77 C. elegans hT2 [umnIs60] I; hT2 [bli-4(e937)] III. Show Description
umnIs60 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous-viable translocation marked with bli-4 and mKate2. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.
CGC80 C. elegans umnIs62 III. Show Description
umnIs62 [myo-2p::mKate2 + NeoR, III:8856215 (intergenic)] III. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.
CGC86 C. elegans dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs67] III. Show Description
umnIs67 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC89 C. elegans tmIn58 [umnIs68] I; lig-4(tm750) III. Show Description
umnIs68 [myo-2p::GFP + NeoR, I:6284001(intergenic)] I. Break points: In(gsp-3 sre-23) I. Covered region (Mb) 3.5 (4.7..8.3). Derived by insertion of myo-2p::GFP transgene into parental strain FX19704 using CRISPR/Cas9.
CGC9 C. elegans umnTi6 III. Show Description
umnTi6 [eft-3p::GFP + unc-119(+)]. Integration site: (III:-1.43 cM/nt 5,935,821). Might still contain unc-119(ed3) in background.
CGC92 C.elegans dpy-5(e61)/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CH1179 C. elegans unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;
CH1180 C. elegans unc-32(e189) emb-9(cg56)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and Uncs which arrest in the L1 stage.
CH1315 C. elegans zmp-1(cg115) III. Show Description
Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant.
CH1445 C. elegans unc-119(ed3) III; cgEx198. Show Description
cgEx198 [(pJC14) bli-1::GFP + unc-119(+)]. Pick non-Unc to maintain. Transgene rescues bli-1 phenoptype. GFP expression is detectable in late L4-adult.
CL2166 C. elegans dvIs19 III. Show Description
dvIs19 [(pAF15)gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP.