Unable to propagate indefinitely: lines become sterile from F10-F28, with short telomeres and fused chromosomes. Hypersensitive to X-irradiation; weak Him phenotype; strong Him phenotype in later generations resulting from X-A fusions. Cross once or twice, freeze down many F2 mrt-2 plates, and go back to these plates every two months for fresh a mrt-2 line. A BstN1 RFLP makes the mrt-2 mutation easy to track.

Unc. Recessive. M-MATING+++ 10-30%WT.

mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. Hermaphrodites expressing compound GFP reporter (see PD4790). Strong pharyngeal muscle expression, easily scored by GFP dissecting scope. mIs12 is tightly linked to unc-4 II, and not to LG III or IV as previously reported. mIs12 homozygous males mate well (ME3).

Dumpy (partially-suppressed Dpy-31). Sqt-3 mediated suppression of dpy-31 lethality. Reference: Novelli et al. (2004) PMID: 15579684.

Unc. Recessive. M-MATING-NO SUCCESS.

Chemotaxis-defective; partly resistant to bacterial infection by Microbacterium nematophilum (Bus phenotype) and Leucobacter Verde2; abnormal surface. Reference: Yook & Hodgkin (2007) PMID: 17151260.

Male/female strain, propagate by crossing. Females are eT5 (III;X); fog-2(q71) V. Males are eT5 (III;X) / eT1(III;V); fog-2 / eT1 (fog-2 III;V). Strain with multichromosomal sex determination. Reference: Strain 21 in Hodgkin (2002) PMID: 12399387.

Temperature-sensitive: Maintain at 15C. Stable, temperature-sensitive tetraploid strain: fertile 4A;3X hermaphrodites and 4A;2X males at 15C; fertile 4A;3X females and feminized sterile 4A;2X males at 25C. Reference: Hodgkin (2002) PMID: 12399387.

eEx512 [dpy-31(+) + sur-5p::GFP]. Pick GFP+ to maintain. Lethal dpy-31 mutant rescued by array containing dpy-31(+) 6.5 kb fragment. Reference: Novelli et al. (2004) PMID: 15579684.

Viable dumpy. Suppressor allele of dpy-17: lethality of dpy-31(e2770) suppressed by e2898. Reference: Novelli et al. (2006) PMID: 16452136.

Weak dumpy. Lethal dpy-31 mutation suppressed by dpy-17 mutation. Reference: Novelli et al. (2006) PMID: 16452136.

Homozygous viable dpy. dpy-31(e2919) homozygotes are almost inviable, but lethality is efficiently suppressed by sqt-3(e2906). Reference: Novelli J, et al., Genetics. 2004 Nov;168(3):1259-73.

Dpy.

eIs101 [dpy-17(E301K) + unc-119(+)]. Weakly dumpy, non-Unc. dpy-31 lethality suppressed by integrated dpy-17(gf) transgene. Reference: Novelli et al. (2006) PMID: 16452136.

No obvious phenotype, wildtype pathogen resistance. Reference: O’Rourke et al. (2005) PMID: 16809667.

eEx650 [ilys-3p::GFP + unc-119(+)]. Pick wild-type to maintain. Transcriptional reporter transgene for ilys-3. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

eEx652 [ilys-1p::DsRed2 + unc-119(+)]. Pick wild-type to maintain. Transcriptional reporter for ilys-1Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

Anatomically normal hermaphrodites and males; Bus (resistant to infection by M. nematophilum); weakly resistant to Leucobacter Verde2; insensitive to Leucobacter Verde1. Reference: J Hodgkin (unpublished).

No obvious phenotype, normal sensitivity to bacterial pathogens. Derived from RB1633; further out-crossed into wild-type background. Reference: O’Rourke et al. (2005) PMID: 16809667.

eEx650 [ilys-4p::GFP + unc-119(+)]. Transcriptional reporter for ilys-4. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

eEx671 [ilys-5p::GFP; unc-119(+)]. Pick wild-type (non-Unc) to maintain. Transcriptional reporter for ilys-5. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

Bus (resistant to infection by M. nematophilum), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. Reference: O'Rourke et al (in preparation).

Notched head. Roller. Variably DpyRoller. Tail abnormalities. M-MATING++ 1-10%WT.

Pick wild-type to maintain. Wild-type hermaphrodites segregate wild-type and dead masculinized embryos. e3026 is nonsense mutation in essential gene Y47D3B.1. Reference: O'Rourke et al (in preparation).

eEx781 [ilys-6p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Transcriptional reporter for ilys-6. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)] IV. Heterozygous strain. Wild-type hermaphrodites segregating wild-type, Dpy-18, and dead eggs (subs-4 homozygotes). Pick wild-type to maintain. Reference: Gravato-Nobre et al (in preparation).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. uIs69 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1] V. Mapping strain. This strain is homozygous for integrated fluorescence markers on LG I, II, IV and V, all of which are easily and independently scored using a fluorescent dissecting microscope, plus an easily scored visible marker (dpy-17) for LGIII. The good markers on all five autosomes facilitate linkage assignment of unmapped mutations, and enable rapid replacement of chromosomes when outcrossing heavily mutagenized strains such as those from the Million Mutation Project.

eEx835 [bah-2(+) + unc-119(+)]. Pick wild-type to maintain. bah-2(gk487599) rescued by transgene. Reference: O'Rourke et al (in preparation).

Viable, small, slow-growing, bleach-sensitive, resistant to Leucobacter Verde1 and Leucobacter Verde2. Lethality of subs-4(e3048) suppressed by bus-22(e3108) mutation. Reference: O'Rourke et al (in preparation).

eEx861 [bus-8(U1,2)::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. bus-8 exon U1 mutation rescued by small U1,2 transgene. Reference: O'Rourke et al (in preparation).

M-MATING+POOR <1%WT. Recessive. Poor movement forward and backward. Unc-36 phenotype. Dead eggs.

Heterozgyotes are WT and segregate WT, Dpys, and Ste or Mel. Pick wild-type individuals and check for correct segregation of progeny to maintain. bli-4 is suppressed by dpy-1 in hT2 homozygotes-only see a very few DpyBli.This strain cannot be distributed to commercial organizations. ep220 is likely Mel. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Slow growth, low fat stores. Viable at 15C, not at 25C. Slightly Dpy, reduced brood size, low penetrance. Maintain under normal conditions. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Liang et al., (2010) PlosOne 5:3 e9869.

epEx141 [sbp-1::GFP::SBP-1 + rol-6(su1006)]. ep79 is a strong allele of sbp-1 (ts lethal). sbp-1 aka pin-1. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Weak sbp-1 allele. sbp-1 aka pin-1. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. NOTE: This strain carries an unknown GFP marker.

Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (homozygotes for hT2) and ham-3(he159) homozygotes, which are Sma, Egl, Adl, Pvl. Maintain by picking GFP+ worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. he159 allele was isolated by John Satterlee from a deletion library at Sander van den Heuvel's lab. Reference: Ertl I, et al. Genetics. 2016 Mar;202(3):961-75.

cerIs7 [lsm-1::GFP(fosmid) + unc-119(+)]. cerIs7 rescues all the temperature-sensitive phenotypes of lsm-1(tm3585). Reporter contains full-length lsm-1 tagged with GFP. GFP was inserted into a fosmid containing lsm-1. GFP is expressed diffusely in the cytoplasm of somatic cells. Under heat shock conditions, GFP accumulates forming cytoplasmic foci. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53.

Partial loss of function allele. prp-8(cer22[R2303G]) point mutation mimics a mutation identified in a Retinitis Pigmentosa patient. Slow growth (Gro). Reference: Kukhtar D, et al. Hum Mol Genet. 2020 Mar 27;29(5):756-765. doi: 10.1093/hmg/ddz315. PMID: 31919495

cerIs2 [lsm-4p::lsm-4::GFP::lsm-4 3'UTR + unc-119(+)]. Reporter contains full-length lsm-4 tagged with GFP. GFP was inserted into a fosmid containing lsm-4. Ubiquitous nuclear GFP expression in somatic and germ cells under normal growth conditions. Cytoplasmic GFP accumulation after exposure to heat-shock. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53.

Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.

Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.

Missense mutations D1135L and S1136W, G1218K and E1219Q, and R1335Q and T1337R were introduced on the Cas9 gene at EG9615 strain, to cause endogenous expression of the Cas9 variant SpG. SpG is efficient for CRISPR on NGN PAM sites. Reference: Vicencio J, et al. Nature Communication, 2022. May 12;13(1):2601. doi: 10.1038/s41467-022-30228-4.

muIs61 [daf-16a::GFP + rol-6(su1006)]. Temperature-sensitive. Maintain at 15 C. Rollers. Reference: Lin K, Hsin H, Libina N, Kenyon C. Nat Genet. 2001 Jun;28(2):139-45.

muEx108 [(pKL99-2) daf-16::GFP/daf16bKO + rol-6(su1006)]. Grows okay at 20C. Rollers should form dauers at 25C. Pick Rollers to maintain.

muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.

muIs164 [tax-4::GFP].

muEx169 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Pick Rollers to maintain. May grow better at 15C.

muEx176 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Pick rollers to maintain -- Low transmission rate! Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.

muEx211[pNL213(ges-1p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.

muEx212[pNL212(myo-3p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.