ZT57 |
C. elegans |
csr-1(fj126) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj126) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj126 was generated by the insertion of a synthetic nuclear export signal (NES). Instead of six amino-acid residues (R8I13) near the N-terminus of CSR-1b, an NES sequence (LNELALKLAGLDI) from the cAMP-dependent protein kinase inhibitor alpha in mammals was inserted into the endogenous csr-1 gene. The DNA sequence encoding the NES has a HindIII site. The fj126 mutation can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and CCGCTGAGGAACGAGATGG, followed by digestion with HindIII. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
ZT62 |
C. elegans |
met-2(ok2307) set-25(n5021) III. Show Description
Maintain at 20C or lower. The met-2 set-25 double mutant exhibits partial sterility and no significant defects in chromosome segregation. MET-2 and SET-25 are the methyltransferases responsible for histone H3K9me2 and H3K9me3. The deletion mutations can be checked by PCR with the following primers: met-2(ok2307), GGTTGATGCGGAGAAGACTG and AATGGATTCGGTGCTTCGTG; set-25(n5021), GAGCCCGTGCCACAGAGTAG and CCTAGAGCGATGTCCTTGATGG. This strain was used as a negative control in the immunodetection of H3K9me2.
|
|
ZU279 |
C. elegans |
unc-119(ed3) III; czIs110. Show Description
czIs110 [mex-5p::GFP::KDEL::pie-1 3UTR + unc-119(+)]. GFP::KDEL is a marker of the luminal ER in the embryo. Reference: Lee et al., J Cell Biol. 2016 Sep 12;214(6):665-76.
|
|
ZZY17 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs17 V. Show Description
zzyIs17 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 6.9 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY25 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs25 V. Show Description
zzyIs25 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 3.5 and 8.45 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY29 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs29 IV. Show Description
zzyIs29 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 1.28 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY31 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs31 IV. Show Description
zzyIs31 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 1.5 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY33 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs34 X. Show Description
zzyIs34 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] X. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 2.37 Mb on Chromosome X. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY37 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs37 IV. Show Description
zzyIs37 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 15.35 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY43 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs43 IV. Show Description
zzyIs43 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY49 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs49 IV. Show Description
zzyIs49 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY64 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs64 X. Show Description
zzyIs64 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] X. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 9.74 and 21.54 Mb on Chromosome X. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY66 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs66 V. Show Description
zzyIs66 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 7.75 and 17.07 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY861 |
C. elegans |
unc-119(tm4063) III; ltIs44 V; stIs10024; zuIs178; zzyIs139. Show Description
ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] V. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. zzyIs139 [his-72p::PH(PLC1delta1)::mCherry::pie-1 3' UTR + unc-119(+)]. Reference: Zhao Z, et al. https://doi.org/10.21203/rs.3.rs-4664717/v1
|
|
COP2002 |
C. elegans |
K09E4.4(knu858) II. Show Description
knu858 is a Y146C point mutation representative of a patient mutation associated with MPSIIIB disease. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.
|
|