ZM8561 |
C. elegans |
daf-2(m596) III; hpEx2906. Show Description
hpEx2906 [myo-2p::RFP + rgef-1p::daf-2]. Transgenic worms dauer easily. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
|
|
ZM8562 |
C. elegans |
daf-2(m596) III; hpEx3369. Show Description
hpEx3369 [myo-2p::RFP + ges-1p(short)::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
|
|
ZM8874 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; hpEx3371. Show Description
hpEx3371 [rgef-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 17671779.
|
|
ZM8969 |
C.elegans |
flp-14(gk1055) III. Show Description
Sluggish, flat, slightly sterile. Derived by out-crossing parental strain VC1957. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
|
|
ZM8988 |
C. elegans |
daf-2(m596) III; hpEx2908. Show Description
hpEx2908 [myo-2p::RFP + dpy-30p::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
|
|
ZM9028 |
C. elegans |
daf-2(m596) III; hpEx2905. Show Description
hpEx2905 [myo-2p::RFP + myo-3p::daf-2]. Pick RFP+ to maintain. Maintain at 15C. Temperature sensitive dauer constitutive. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
|
|
ZM9172 |
C. elegans |
unc-25(e156) III; ljIs131. Show Description
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZM9441 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; hpEx3370. Show Description
hpEx3370 [dpy-30p::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic strain expressing DAF-16A isoform from pan-tissue dpy-30 promoter. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 17671779.
|
|
ZM9442 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; hpEx3373. Show Description
hpEx3373 [ges-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 17671779.
|
|
ZM9443 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; hpEx3507. Show Description
hpEx3507 [ges-1p::GFP::daf-16d/f::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 17671779.
|
|
ZM9444 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; hpEx3508. Show Description
hpEx3508 [ges-1p::daf-16a,d&f + myo-2p::RFP]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. ges-1 promoter drives expression DAF-16A,D&F transgene in intestine. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 17671779.
|
|
ZM9474 |
C elegans |
flp-14(gk1055) III; hpSi38. Show Description
hpSi38 [flp-14(+) + NeoR]. Superficially wild-type. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant phenotype. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
|
|
ZM9519 |
C. elegans |
flp-14(gk1055) III; hpSi38; hpIs201. Show Description
hpSi38 [flp-14(+) + NeoR]. hpIs201[ceh-10p::GFP + lin-15(+)]. GFP expression in RID neuron. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant behavioral defects and RID axon defects. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
|
|
ZM9573 |
C. elegans |
unc-25(e156) III; zxIs6; ljIs131. Show Description
zxIs6 [unc-17p::ChR2::YFP + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Cholinergic activation. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZM9660 |
C. elegans |
unc-25(e156) III; hpIs673; ljIs131. Show Description
hpIs673 [rgef-1p::Chrimson::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. All neurons are marked with red fluorescence. Pan-neuronal activation and muscle contraction upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZT2 |
C. elegans |
drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.
|
|
ZU279 |
C. elegans |
unc-119(ed3) III; czIs110. Show Description
czIs110 [mex-5p::GFP::KDEL::pie-1 3UTR + unc-119(+)]. GFP::KDEL is a marker of the luminal ER in the embryo. Reference: Lee et al., J Cell Biol. 2016 Sep 12;214(6):665-76.
|
|
ZZY17 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs17 V. Show Description
zzyIs17 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 6.9 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY25 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs25 V. Show Description
zzyIs25 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 3.5 and 8.45 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY29 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs29 IV. Show Description
zzyIs29 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 1.28 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY31 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs31 IV. Show Description
zzyIs31 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 1.5 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY33 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs34 X. Show Description
zzyIs34 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] X. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 2.37 Mb on Chromosome X. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY37 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs37 IV. Show Description
zzyIs37 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 15.35 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY43 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs43 IV. Show Description
zzyIs43 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY49 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs49 IV. Show Description
zzyIs49 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY64 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs64 X. Show Description
zzyIs64 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] X. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 9.74 and 21.54 Mb on Chromosome X. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
ZZY66 |
C. briggsae |
Cbr-unc-119(st20000) III; zzyIs66 V. Show Description
zzyIs66 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 7.75 and 17.07 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
|
|
COP2002 |
C. elegans |
K09E4.4(knu858) II. Show Description
knu858 is a Y146C point mutation representative of a patient mutation associated with MPSIIIB disease. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.
|
|