More Fields
Strain Species Genotype
VC391 C. elegans heh-1(ok603)/sC1 [dpy-1(s2170)] III. Show Description
R148.6. Heterozygotes are WT, and segregate WT, Dpy sC1 homozygotes, and ok603 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC392 C. elegans dac-1(gk211) III. Show Description
B0412.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC393 C. elegans nduf-2.2(ok437) III. Show Description
T26A5.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3949 C. elegans F17C8.9(gk5023[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1071 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACACTTTTTACAGGAAAATTTCTTGTCGA; Right flanking sequence: GGAGCTCTTGCGGCAAGCAATTTAGGATTT. See WormBase Variation gk5023 for details.
VC395 C. elegans dac-1(gk213) III. Show Description
B0412.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3959 C. elegans ubc-7(gk5037[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 551 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TATTTCGGTTATTTTTCATTGTTTAGACGA; Right flanking sequence: TAGGGAGGATTGCTCCATCTATCTAGAAAT. See WormBase Variation gk5037 for details.
VC3974 C. elegans C06G4.1(gk5052[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2869 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAGACAAATCGATATTTGTATCCAGCG; Right flanking sequence: TCTTCCAAGTTCGTGTTCCAGAAAACATGG. See WormBase Variation gk5052 for details.
VC3983 C. elegans mrps-26(gk5010[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Recessive lethal deletion balanced by qC1. Deletion of 993 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGGACGATGTCTTTTGGCATCTGCCATGTC; Right flanking sequence: GGACATGATGTGAGTTATTTTTGAACATCG. See WormBase Variation gk5010 for details.
VC3988 C. elegans H04D03.3(gk5060[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2070 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTCCGATTTAAAACTGTCTCTTCCTCTA; Right flanking sequence: CTGGTCATGTTTTTCGAATATTCCACAATT. See WormBase Variation gk5060 for details.
VC3992 C. elegans lron-10(gk5064[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2073 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGAGCACTGAACCAGCTTTTCGCCGCCT; Right flanking sequence: GATGGAGGTCATGCCTAAACGAAACAAAAA. See WormBase Variation gk5064 for details.
VC402 C. elegans +/eT1 III; cdc-25.2(ok597)/eT1 V. Show Description
F16B4.8. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok597 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4050 C. elegans C29F9.6(gk5124[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1241 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCGATTTTCCCAAATTTACTGATCCGATG ; Right flanking sequence: TATGGAAGGCACTTCCAAGGACTTCCAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4099 C. elegans C29E4.12(gk5046[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Homozygous lethal deletion balanced by qC1. Deletion of 304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGTACATTTTCAAAATTAAAGTATGGCCT ; Right flanking sequence: TGGCGAGAAGAGTGTTGAAGAGGCTGCTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC411 C. elegans +/mT1 II; kin-19(ok602)/mT1 [dpy-10(e128)] III. Show Description
C03C10.1. Heterozygotes are WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous ok602 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4112 C. elegans T03F6.10(gk5189) III. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5189 mutation is C->T, flanking sequences AATGAGAGCAATGAGAAGAAGCATAAAAAT and TGGAAATATAGAAATATACTTACTTTTAAG.
VC4114 C. elegans C01A2.6(gk5192) I; F25B5.3(gk5193) III. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5192 mutation is G->A, flanking sequences TCCAAGCAAGGCACAAATTCTTGAAGCTTG and GAAAATGGAGCCGAACCTTGGCAATCTACC. The gk5193 mutation is C->T, flanking sequences AGACGATTCGAAAGTCGACAATCAATCTTA and AATTGCGAAGTAAGTGAAAGTGAGAACTTT.
VC4115 C. elegans K12C11.6(gk5190) abhd-11.1(gk5194) C01A2.6(gk5192) I; F25B5.3(gk5193) III. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5192 mutation is G->A, flanking sequences TCCAAGCAAGGCACAAATTCTTGAAGCTTG and GAAAATGGAGCCGAACCTTGGCAATCTACC. The gk5193 mutation is C->T, flanking sequences AGACGATTCGAAAGTCGACAATCAATCTTA and AATTGCGAAGTAAGTGAAAGTGAGAACTTT. The gk5194 mutation is G->A, flanking sequences TACCTGGGCTCTTTGGAACAAAAGAAAACT and GATCCAAGTCGGCAAAGATCTCAGTCAACG.
VC4126 C. elegans Y39G10AR.15(gk5206) ZC334.7(gk5207) I; cnnm-5(gk5208) III. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5206 mutation is T->A, flanking sequences GGCCTTTCCAACTTAGAATTTTGGTCGTCC and GAAAAATAACGAAGTTATGGTGAACTCCCT. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG.
VC4127 C. elegans ZC334.7(gk5207) I; cnnm-5(gk5208) III; K08H2.10(gk5209) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG. The gk5209 mutation is G->T, flanking sequences AAAAAGGAAGACATTGAGTTTGAGGATACA and AACGTCGAATTCATTCTCGAAGTGTTCGAA.
VC4137 C. elegans ptr-9(gk5220[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2787 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATAATATCAAGTCGTGTATTTGTAGCTGC ; Right flanking sequence: GATGTCTGAAAATGTTTTAAATAATTCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4141 C. elegans nipa-1(gk5224[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 3485 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAAAAAAGAACAAAAACTGGGTGAGGATC ; Right flanking sequence: ATACCCATAACCGCCTTCCGATGCCCGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4157 C. elegans glct-4(gk5241) I; C05D2.8(gk5242) III. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5241 mutation is C->T, flanking sequences GAGCTTCCACAACGACTCCTCCGACTAGGC and TGAAATTTTAGGGGGTTCTGGGATTGAGGT. The gk5242 mutation is C->T, flanking sequences ACAATATCCCTCTCTCCTCCATCACCACCC and ACTGAGAATTCATCAAATTTTCTTTATTGT.
VC4189 C. elegans K03H1.13(gk5275[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1796 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCGAAAACACGATATTTGATTTGAAAGCA ; Right flanking sequence: GATTCATCCGTTACAACTTCTATAGATTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4203 C. elegans ptr-19(gk5288[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 4684 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGGTGATCATCGAAGATAGAATATTGGGGA; Right flanking sequence: TAGTGATATTGGTAGACGAGGTCCTTACCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4205 C. elegans Y71H2AM.20(gk5290[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2953 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGATTCGACGACAGATGACGAATGGACGG. Right flanking sequence: CACGGATTCAGGTCGAACACATTTTTAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4209 C. elegans C29F9.8(gk5294) III; fbxa-139(gk5295) V. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5294 mutation is C->T, flanking sequences CAGAAAAGTACAAATTTGCCTGGATTTTGC and TGAAAATTTTTATCAAAAAACCGGCAAATT. The gk5295 mutation is G->A, flanking sequences GATTAAATCTGATTAGATGAAGCTCAAATC and ATCGAAGTTGTAGAGATACTCCATTGGCAT.
VC4237 C. elegans nifk-1(gk5029[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Homozygous lethal or sterile deletion balanced by qC1. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous qC1 is non-GFP sterile TS Dpy. Left flanking sequence: CAGATCTCAGACACAATGGTTGCCCAGAAT; Right flanking sequence: CCCGTCCAGCTGCTGTCGAAAAGAAAACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4238 C. elegans R05D3.8(gk5088[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Homozygous lethal or sterile deletion balanced by qC1. Deletion of 1366 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous qC1 is non-GFP sterile TS Dpy. Left flanking sequence: TCATTTTGTATAATGTTTTATTCTCGGTCA; Right flanking sequence: GGAGGTAGAATGCACTCGTATAAAGTTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4248 C. elegans brc-1(gk5332[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 9229 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CATTTTTATTTGAATTTTAGGCACTTAATT; Right flanking sequence: AGGATACTCTTCGATTCGCTGGTTTCTCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4251 C. elegans C44B11.1(gk5335[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2067 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCGATTTTCAATTTTATTTTTGGACCGGAA; Right flanking sequence: AACGGAACAGTGACACACTTCGAGCTTGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4255 C. elegans F56C9.3(gk5339[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2262 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACAAATTCGCGCCGTCCACAGTACCTTTG. Right flanking sequence: CTCACAGATCAATCGGTTCGATTAAAATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4260 C. elegans Y71H2AM.9(gk5344[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 8243 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GATCGATCACCTTCTCGCCGTGATTTTCCA; Right flanking sequence: AATGCAACTGCGCTCCATTGCTACGCGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4261 C. elegans lron-12(gk5345[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2072 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCTCCGATTGTATTTCTCAATATTTTAAG; Right flanking sequence: GGACAAGTGTCTCGGAGGGCATTTGAATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4263 C. elegans pef-1(gk5346[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 7585 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCGATCAACCAATCTAAAGGCCTCCAGCA; Right flanking sequence: TTTCATGTCTATGCGTCTTGTCACTTATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4294 C. elegans ntl-9(gk5277[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2075 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGCCTCTCCGGCAACTCAAGCTCAACAAAC; Right flanking sequence: TGATCTACCTCGTCTTCTTCGTCCTACTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4295 C. elegans lron-5(gk5278[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2750 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATCTCATACAGTTGTATGCAACCGCCCGTC; Right flanking sequence: GTTGACACAACTCGTAACTTTTATTCAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4297 C. elegans Y71H2B.2(gk5380[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2972 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AACAATCGAGAAATGCTAATCAAAAGAAAA. Right flanking sequence: TGGCAAACGAAGAGCAGCTCGCCACCGCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4309 C. elegans wah-1(gk5392[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 9220 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGTTTACACGCCCACCAATCTTCCCCGCCC. Right flanking sequence: TTCGGACCTTCACTGGATGTAGCTCGGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4310 C. elegans C18D11.10(gk5393[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1832 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATAACCCGAAGAGGAGATGCGAGAACGATG; Right flanking sequence: CTAGGTGTCAATGTGAAATGTTTTTGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4313 C. elegans toh-1(gk5396[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 4219 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTAACGTGTCCTTAAAAAGACTCAAATGTT; Right flanking sequence: AGGTAGCCTGAAATTAGATTTAAAGTAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4322 C. elegans mcm-5(gk5405[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2762 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CACGACGGACCAAATTATCGATAACCTTCT; Right flanking sequence: CCGGGGTTGTCGAGGTTAGACATATTGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4324 C. elegans R10E4.6(gk5407[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1401 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GACGCCGATTTCGAATTTTATTATTGATTC; Right flanking sequence: TGGAGCTATGAATAATTATTTCAAATTCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4326 C. elegans snpc-3.4(gk5409[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2532 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AGAGACTGGCGCCGCCCGTGCTTCCCTCCC. Right flanking sequence: CCTACACACACTTCTGCAGGACATGCTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4339 C. elegans ugt-66(gk5422[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2473 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AAAATTTCAAAATATTAAATGAAGCCGTTG; Right flanking sequence: CAGGGAGGTGTCACAATTATTTGTGTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4349 C. elegans bud-31(gk5432[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1392 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GACGGAACTTCCACCATTCTGTGAATTATA. Right flanking sequence: GTAGAACGGTGTCCAGCCATTATAGCAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4353 C. elegans F10E9.2(gk5436[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1358 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GAAATTTGTTCAGTACTGGAATGAATTCCT; Right flanking sequence: AGGAGAAGAAAGAGAAGAAAAGTGCGGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4356 C. elegans M01G5.1(gk5439[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 10206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATTCGATGCCAAATCATGTGGCAGCTCAA. Right flanking sequence: GGGGAATTCGAATTTCTTAATGGCTTGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4366 C. elegans srg-1(gk5448[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1163 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AAATTTTTTGATTTTGAGTTGCCGAAGTAA; Right flanking sequence: CGGCATTCGGTATTCAGCTTCAATTTTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4371 C. elegans Y41C4A.7(gk5452[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 751 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GACATCACGAATTTGTCGCCGTTTCCGGTT; Right flanking sequence: TCAACGGGTAAGTCTTGTGTGCCTGCCTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4389 C. elegans tftc-5(gk5467[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
[NOTE: Please see RG5031 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2935 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCTCGTATTATGGCGGAACGGAAACCTCAG; Right flanking sequence: GCAATGAATGAGCTAGTGGCTGTTGTAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.