More Fields
Strain Species Genotype
VC2736 C. elegans Y48E1B.2(ok3557)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
Y48E1B.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3557 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCGCGTACTTCTCCAACAAT. External right primer: TCTCGCAATCGGAATCTTCT. Internal left primer: CAGCTCTCTCCACCGTCTTC. Internal right primer: ACGTTCAGGAGGTCACCAAC. Internal WT amplicon: 1169 bp. Deletion size: 674 bp. Deletion left flank: GCAAGCCTCGGGTAGATGCTTCCGGGAAGA. Deletion right flank: CAGAATCTTCTGATAGCTGGGCTCCTGGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2740 C. elegans lgc-12(ok3546) III. Show Description
R13A5.4. External left primer: AGCGAGAGCTGGTGAAACAT. External right primer: CTCGGACAATTTTCGCGTAT. Internal left primer: CCAATTTACTCGACCTGTAAAAA. Internal right primer: TGCATCAAATTAGGTGTCCG. Internal WT amplicon: 1216 bp. Deletion size: 744 bp. Deletion left flank: ACGTAAGTTATGGTAAATAACATACTTTTT. Deletion right flank: GCAATACCGTTCCAGCATTTTCACAGTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2754 C. elegans hsp-60(ok3508)/sC1 [dpy-1(s2170)] III. Show Description
Y22D7AL.5. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok3508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAATTGATTTTTCCCGCTGA. External right primer: AGGGGAAAAAGAGCCGTAAA. Internal left primer: GAAATTTTGGTTTTCCTGCG. Internal right primer: CAAATGGCTCAGAGCACAAA. Internal WT amplicon: 1227 bp. Deletion size: 611 bp. Deletion left flank: AAAAATTTGAATTTTTCGTGAAAATTTGAA. Deletion right flank: GCTCTCAATCTCTCATTGAAATAACGACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2776 C. elegans +/mT1 II; rnr-2(ok3357)/mT1 [dpy-10(e128)] III. Show Description
C03C10.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3357 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTCTCTCGGCTTCATTCACC. External right primer: GTGTAAAGTCCGCGAAGAGG. Internal left primer: ATACTCGGAAACCCGCTTCT. Internal right primer: ATGCCTTCGAATTTACAGCC. Internal WT amplicon: 1159 bp. Deletion size: 691 bp. Deletion left flank: TTCGATGGCCACAGCGTCCTTGATGATATC. Deletion right flank: TGCCTTTTTGTAGAAGTTCCAGATGTCATG. Insertion Sequence: ATTGATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2783 C. elegans F35G121.4(gk3152) III; hlh-34(gk1280) V. Show Description
T01D3.2, F35G12.4. The gk1280 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 245 bp. Deletion left flank: TTGCACATTTGAGGCCAATTAAGGTCACAA. Deletion right flank: TTCAAAACTTGTAACTATAATAAAATATTT. Insertion Sequence: ATTTCAGGATGTTTTTGTGAAAG. The gk3152 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2787 C. elegans +/mT1 II; knl-1(ok3457)/mT1 [dpy-10(e128)] III. Show Description
C02F5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3457 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCGATGGAATTGGACAACA. External right primer: ATTGTAGGCCTGATGCAAGG. Internal left primer: AGGCCATAATGAAACATCGC. Internal right primer: GTGAAGGCGGCATCTAAAAT. Internal WT amplicon: 1188 bp. Deletion size: 602 bp. Deletion left flank: GAATGGGCAAACAATGGAAGCTCTGACAGA. Deletion right flank: CAGCTAAGAGGTCTCGATAAGATGGCTGTC. Insertion Sequence: GGAAATTCGAAAATGGCTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2789 C. elegans C18E3.2(ok3161) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C18E3.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3161 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAGGAAGTGCTCCACAAAT. External right primer: AACTCGTGTCGCTTCTGGTT. Internal left primer: CCATTGCCGAAAAAGAAGAA. Internal right primer: CACCTTTTGGAACATGTATCTG. Internal WT amplicon: 1250 bp. Deletion size: 1122 bp. Deletion left flank: AAAGAAGAAGTATGCGGATAAATGTATTCA. Deletion right flank: GAGGAAGGAGTTCAAAGGTATTTGCCGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2800 C. elegans F15D4.3(ok3493)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
F15D4.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3493 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGATTCGGCAAGAGAGGTCA. External right primer: AAAGTTTTGCTCCTGTGCGT. Internal left primer: TAATAATCCCTTGAGCCCCC. Internal right primer: AACGATTTCTTTCACAAAGTGGA. Internal WT amplicon: 1187 bp. Deletion size: 531 bp. Deletion left flank: ATTGAGTTTTTTCTATGAAAGACCTAGCGC. Deletion right flank: AAAAATAAAATAAATAACACGGAAACCGCG. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2802 C. elegans K11D9.3(gk3223) III; srv-13(gk3224) IV; hlh-34(gk1211) V. Show Description
This strain is homozygous for a deletion (gk1211) in T01D3.2, detectable by PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 301 bp. Deletion left flank: TTAAAAAACAGAAAAAAAATTAAAAATATA. Deletion right flank: CATCTCCGCGCCTGTCCAGTATCACAAAGA. Validation: gk1211 passed by CGH. Other deletions (gk3223, gk3224) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2805 C. elegans Y111B2A.1(gk1164) III. Show Description
Y111B2A.1. External left primer: GAAGCTCGAAGAGTGGGATG. External right primer: AGTGTATGCAGCGTGTTTGC. Internal left primer: CCTCTTTGAATTACCGCCAA. Internal right primer: TTTCAGATGAAACGTGCGAG. Internal WT amplicon: 2262 bp. Deletion size: 614 bp. Deletion left flank: TTAATTAATTTCACTGATTTACGCCTGTAA. Deletion right flank: AAAATTGTTTCCAGCCGCTGCGACAATGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2819 C. elegans F15D4.3(ok3521)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
F15D4.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3521 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGATTCGGCAAGAGAGGTCA. External right primer: AAAGTTTTGCTCCTGTGCGT. Internal left primer: TAATAATCCCTTGAGCCCCC. Internal right primer: AACGATTTCTTTCACAAAGTGGA. Internal WT amplicon: 1187 bp. Deletion size: 378 bp. Deletion left flank: CTTCTCTTCTCCCTGTGTGTACCAGTGTAC. Deletion right flank: TCGAATCTGGAAATTTTGAAAATAAATTAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2820 C. elegans eat-2(ok3528)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
Y48B6A.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3528 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTTTTCTCCGCACTCTGGT. External right primer: TGTGGCACAGAACTACGCTC. Internal left primer: CCAAAATGTTGCTCAACGAG. Internal right primer: CGCAAGCCTGTAAATGTGAA. Internal WT amplicon: 1182 bp. Deletion size: 614 bp. Deletion left flank: AAATGTTGCTCAACGAGATCAAAATCGATG. Deletion right flank: TAGGGGTACTGTAGGACAACTGTGGAAGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2824 C. elegans H28O16.1(ok2203) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
H28O16.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2203 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAATCCTGACAGCTCGTTGG. External right primer: TTCGAAACAGGAGCTTTGCT. Internal left primer: TGTTGTCCAAACGCATTGTT. Internal right primer: ATTCTCGCAGAACACACACG. Internal WT amplicon: 2289 bp. Deletion size: 1121 bp. Deletion left flank: GACGTGTTGTTGACGCCCTCGGAAACCCAA. Deletion right flank: ATACCTCGACAAGGTCGACCCATCCGCCAT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2825 C. elegans rpl-30(ok3566) I/hT2g[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y106G6H.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3566 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. xternal left primer: CCAAAAACCGGAAAAAGACA. External right primer: AAAAACGTCCGATGCAATTC. Internal left primer: AGTGTTTCAAGGGAGGAGGG. Internal right primer: TCCATCCGTGACATCGTTTA. Internal WT amplicon: 1153 bp. Deletion size: 474 bp. Deletion left flank: ATTAGAAGTTCACGCAGTTATTTTTTCTAT. Deletion right flank: CTACAACGGAAACAACATTGAGCTCGGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2828 C. elegans Y79H2A.3(gk1219) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y79H2A.3. Maternal-effect lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1219 homozygotes (Mel; F2 homozygotes arrest as early larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAACATGCTTCTTCCATGCC. External right primer: AGCGAAATTTGGACTAGCGA. Internal left primer: TTCATTGCGTGATATTCCGA. Internal right primer: TCTGGACGTGTGCTACTTGC. Internal WT amplicon: 1396 bp. Deletion size: 1073 bp. Deletion left flank: GTTCATCACCAGCATTAATGAGATATCGAT. Deletion right flank: TAGCTAATTTTGAACCGCCATAAAACTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2837 C. elegans +/mT1 II; ugtp-1(ok3492)/mT1 [dpy-10(e128)] III. Show Description
ZK370.7. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3492 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCAATCCGTTTCTGTCGTCT. External right primer: ATGATGCTCTTTCTCGGTCG. Internal left primer: TTGGCGAGAATTTATGAGCC. Internal right primer: TCGATGGATGGCAATTACAC. Internal WT amplicon: 1168 bp. Deletion size: 505 bp. Deletion left flank: TTAAGTTTATACAATTAAAGCTTTTGGCTA. Deletion right flank: TTTTTCAAACGATTTGAAAAAAAAACCCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2838 C. elegans +/mT1 II; F09G8.3(ok3529)/mT1 [dpy-10(e128)] III. Show Description
F009G8.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3529 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACAACATGTGGCGATGATG. External right primer: GCTTCTTTCGTTTTTCCGTG. Internal left primer: GCAGAGTTCGAGACAGGACG. Internal right primer: CTCATTCCTCCACTTCGCAT. Internal WT amplicon: 1193 bp. Deletion size: 753 bp. Deletion left flank: AGACAGGACGTCGACATCTTGCCAAAATGA. Deletion right flank: ATTTTTAATTAAACAAATTTTCTCTAATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2841 C. elegans mboa-6(gk1217)/sC1 [dpy-1(s2170)] III. Show Description
R155.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk1217 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAGCAAATTTTTGCGGG. External right primer: AAGTACGCAAACACCTTGGC. Internal left primer: GCTAACTCGGCCTTTACACG. Internal right primer: TTTGGAAACCCGTTGGATTA. Internal WT amplicon: 2401 bp. Deletion size: 1464 bp. Deletion left flank: GTCGATTGGACCCAAAAAATAGAATTTTCA. Deletion right flank: GTGAAAAAGTACAAGAAATTCAACTTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2846 C. elegans T09B4.7(gk1215) I; npp-9(gk3059) III. Show Description
T09B4.7, F59A2.1. The allele gk1215 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CGTCTTTCACTCGCCTTTTC. External right primer: CAAAATGGAGAGTACCCGGA. Internal left primer: TATTCTGTATGACGCCGCAC. Internal right primer: CCGGCCTGATCTGAGAGTAA. Internal WT amplicon: 2551 bp. Deletion size: 661 bp. Deletion left flank: AAAGAAATAAAGCTCCAGATGATATCACGT. Deletion right flank: GGAAAGCAACTTATCATTTCCCATACCAAC. The allele gk3059 was identified by CGH but not confirmed by PCR. Left flanking probe: TTCCATTCTCAATATTTGAAGGGAGTGTCTCCTCCGAAATGGTCACCTGG. Right flanking probe: CAGAACATGGTTTGCTCTCCTTCTTCTCCAGTTTTCACCTCGACAAGATC. Left deleted probe: GTCTCCTCCGAAATGGTCACCTGGTCTCGTCGCATAACAACTCTCCACGA. Right deleted probe: CGTTGGCATAAATGTAGAGTTTTGAACGATTGCAGAACATGGTTTGCTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2853 C. elegans +/mT1 II; pst-2(ok3603)/mT1 [dpy-10(e128)] III. Show Description
F54E7.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3603 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGCATAACACGAAACGAA. External right primer: ACCCGAGCCCTGATAAAAAG. Internal left primer: GCGATTTGTGCGTCAGTAAA. Internal right primer: TTTAAGTTCTAAACCGTCATTGG. Internal WT amplicon: 1236 bp. Deletion size: 437 bp. Deletion left flank: ACTTTCGAATGCATCCGTTGGATATTTAAA. Deletion right flank: CTACGCACTGATCCTCTCATGTCTTGGATA. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2864 C. elegans Y75B8A.6(ok2294) III. Show Description
Y75B8A.6. External left primer: ACGGATCCCTGAACAGAATG. External right primer: TATATTCACGGGGTTCTGGC. Internal left primer: TTGCTGGAGAGAAAAACGGT. Internal right primer: GGAAACCAGAAATCCGTGAA. Internal WT amplicon: 3060 bp. Deletion size: 903 bp. Deletion left flank: ATACGAAAAAATTCAAAAATTCAAAAAGGA. Deletion right flank: TATATTGAACTCGTTTCACATCAAAATGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC287 C. elegans hmt-1(gk161) III. Show Description
W09D6.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC288 C. elegans dac-1(gk198) III. Show Description
B0412.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC291 C. elegans tag-51(ok474)/sC1 [dpy-1(s2170)] III. Show Description
K02F3.1, K02F3.12. Heterozygotes are WT, and segregate WT, Dpy sC1 homozygotes, and ok474 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2913 C. elegans cTe154X.1(gk3136) III; flp-10&T06C10.3(gk3137) kin-26(gk1263) IV. Show Description
T06C10.4, T06C10.6, T06C10.3, cTe154X.1. The gk1263 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GATGGAGTCGGTGGTGTTCT. External right primer: ATTTTTCAACTGCGAGCGAT. Internal left primer: GCTGGCAGTATTCGGATGAT. Internal right primer: AAATTTGCCGAAACGTGAAC. Internal WT amplicon: 2806 bp. Deletion size: 1036 bp. Deletion left flank: ACAAAATAAACGAGTTTAAAAAAACATTCA. Deletion right flank: TAACAAGGTACAATGGTTCCTGTAGTACTC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2939 C. elegans Y39A1C.1(gk1241) III. Show Description
Y39A1C.1. External left primer: GGTAATGCCGTCTGGAAATG. External right primer: CTGCGTCTCCTCCTCTTCAC. Internal left primer: CCATTCCCTGAAGTTGCAGT. Internal right primer: TGAGCCAGTATGACGTGAGC. Internal WT amplicon: 935 bp. Deletion size: 413 bp. Deletion left flank: CACAGAAACGTGGAATTTCTCTCCCCAGTC. Deletion right flank: GATTTTTCAAGCAATTTTCAGTAGAAACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2942 C. elegans +/mT1 II; B0285.1(ok3664)/mT1 [dpy-10(e128)] III. Show Description
B0285.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3664 homozygotes (arrest stage/phenotype undetermined). Note: mT1 may have acquired an early lethal in this strain, so mT1 homozygotes may not be seen. Pick WT and check for correct segregation of progeny to maintain. External left primer: TGACATTCATTTTGCCGCTA. External right primer: TCCTTCTCCCATAGTCGTGC. Internal left primer: CTTAGCTCCATACCACCACCA. Internal right primer: CTCGCCTCTGCAAACAATTT. Internal WT amplicon: 1354 bp. Deletion size: 632 bp. Deletion left flank: GATAGCCACTCGGCCTGTGTAAGTTATTTG. Deletion right flank: TTCATCATAAGAATATCGTCCGTCTTATGG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2948 C. elegans frm-2(ok3690) III. Show Description
frm-2. Homozygous viable deletion, detectable by nested PCR. External left primer: AGAGGGGAATATCCCGATTG. External right primer: AGAACAATGGCCAAATCCAG. Internal left primer: GTTGCATTGGGGGAACAATA. Internal right primer: CGTTCGTTTTTCACTTGACG. Internal WT amplicon: 1105 bp. Deletion size: 411 bp. Deletion left flank: CCTGGAAAGTTTATGGAGTATTTGAAAACA. Deletion right flank: ATTTTGCATGGGTTCGCTGTTGATCATTGG. Insertion sequence at break: AAAACCTTGTATAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2960 C. elegans C50F2.3(ok3662) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C50F2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3662 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATGGCCGACAAAGAAAATG. External right primer: TTTTTCCAACTTTTCCGTGC. Internal left primer: ATGCCGAACTCTGAGACGAT. Internal right primer: AAAAGTTGGCGAAATTGGTG. Internal WT amplicon: 1186 bp. Deletion size: 656 bp. Deletion left flank: TGGAGAGCACTCTGTGACACTTATGAGAGA. Deletion right flank: CGAGAAGTGTCGATTATGATGCAAGAAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2972 C. elegans R148.3(ok3525)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
R148.3. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3525 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGAGACAACAGTGAGCCGAC. External right primer: GCTGCCTTCCATGACTTCTC. Internal left primer: CTCATGCTCAACGTCAGGAA. Internal right primer: TGTCGATCGTCTTCTCATCG. Internal WT amplicon: 1190 bp. Deletion size: 862 bp. Deletion left flank: GACGGCGGAGAATCGAGATTTGACAGATAA. Deletion right flank: TCATCGATGAGAAGACGATCGACACGTCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2982 C. elegans gkDf24 I; ikke-1(gk1264) III. Show Description
F11A6.1, W04G5.6, T22H2.1, T22H2.6, F11A6.2, T22H2.5, T22H2.3, R107.4, T22H2.2, W04G5.5, W04G5.10, W04G5.1, W04G5.15, W04G5.9, W04G5.12, W04G5.13, W04G5.11, W04G5.8, W04G5.7, W04G5.14, F11A6.8, F11A6.11, F11A6.5, F11A6.9, F11A6.13, F11A6.4, F11A6.10, F11A6.14, F11A6.6, F11A6.7, F11A6.12, T22H2.4, T22H2.7. The gk1264 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: ATTCTCGCAACAAATCCGAC. External right primer: CAATCGTCATTACACACGGC. Internal left primer: GCTCCGGTTTAGGGAATTGT. Internal right primer: AGTAGCAGTTTGGAAGCGGA. Internal WT amplicon: 2692 bp. Deletion size: 722 bp. Deletion left flank: TGAAGGTTCATGGAAAAAGCTGCGTAGAAG. Deletion right flank: TGCATTTGATGAAAGTCCTCTGTGATTCTT. The gkDf24 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2986 C. elegans dpy-1(gk3073) III. Show Description
Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2987 C. elegans dpy-1(gk3074) III. Show Description
Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2999 C. elegans R151.2(gk3067) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R151.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3067 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACAAAGATCACTCAATCCATCA. External right primer: AACATCGTCGTTCAGAATCTCAT. Internal left primer: TTTCTCTTGGGACCTTTGGTAA. Internal right primer: AAAATGAGCAGAATCGAATGGT. Internal WT amplicon: 1962 bp. Deletion size: 1090 bp. Deletion left flank: AGTTTTGGCAACTTATCAGTTAGAATAAAA. Deletion right flank: CCTCAAAATTTCAGATTGGTTGAAGCCGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC301 C. elegans ant-1.1(gk172)/eT1 III; +/eT1 V. Show Description
T27E9.1. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk172 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3015 C. elegans T20G5.10(ok3707) III. Show Description
T20G5.10. External left primer: TTGTGAAGGAGATTGCAACG. External right primer: GGAAGCTCAGTTGAGGGTTG. Internal left primer: TCTGTTTCATTTCATGTGCGA. Internal right primer: TTATCTCCGATTGGGTCTCG. Internal WT amplicon: 1347 bp. Deletion size: 645 bp. Deletion left flank: TTCTACCTCTCTGTTTCATTTCATGTGCGA. Deletion right flank: CGAGACCCAATCGGAGATAATAGTAAAACC. Insertion Sequence: TTTTCTATTTAACAACAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3038 C. elegans C02F5.7(ok3741) III. Show Description
C02F5.7. External left primer: GGAGCATACTTGCGTTGGAT. External right primer: GTGTCGAGACCGGGTACTGT. Internal left primer: ATCTAACTGGCAGCGCGT. Internal right primer: CGAACGATTGCTTCTTTTGA. Internal WT amplicon: 1100 bp. Deletion size: 707 bp. Deletion left flank: TCTAACTGGCAGCGCGTCGACTTATTCACA. Deletion right flank: AGTACTGGAATTATCTGGATGCACACTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3049 C. elegans hel-1(ok3698)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
C26D10.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3698 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAACCAAGTTCTGGCCATCT. External right primer: TTCCATTCTCCTTCCACCTG. Internal left primer: GGCGGAGAACATCATCACTT. Internal right primer: TTTCGGATCGTTTCGCTACT. Internal WT amplicon: 1141 bp. Deletion size: 721 bp. Deletion left flank: TGTCGCACTCGTCCAGGACGAAGTACTTGA. Deletion right flank: GAAATTTAGTAAATAACCTCACAAAAACAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3056 C. elegans zip-2(ok3730) III. Show Description
K02F3.4. External left primer: ATTGTTCAGCTATCGGCTCC. External right primer: AGCTGCTGGAGTTGGAGGTA. Internal left primer: ACTCACCGCTCCAGGATG. Internal right primer: TGAGGTTGGTGAATAAGGGA. Internal WT amplicon: 1145 bp. Deletion size: 476 bp. Deletion left flank: GACACGACGTTCCCTACCGAAAGCGGACCG. Deletion right flank: AATTTAAACATTAAAAACCATTTCAGTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3075 C. elegans tsp-3(ok3729) III. Show Description
Y39E4B.4. External left primer: AAACCGCATTTGTCCGAATA. External right primer: TGCCCCCACTAACCAATATC. Internal left primer: TGTCTTAAAGCAAACGTGCAA. Internal right primer: ACTACTGCCGGCTCTATCGG. Internal WT amplicon: 1181 bp. Deletion size: 351 bp. Deletion left flank: GTTTTGATAAAGGCTTCGAATCGGAAATTC. Deletion right flank: AGGCTCCATACTTTCTGTTTATGGTTATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3078 C. elegans F10E9.1(ok3764) III. Show Description
F10E9.1. External left primer: AGCTGAAAAATGCTGTCGGT. External right primer: TTAAATGTGCAATGGTCCGA. Internal left primer: TACTGCACCACCGTTCAAAA. Internal right primer: CAGCTTCCTCATTTTCTGTTCTT. Internal WT amplicon: 1235 bp. Deletion size: 625 bp. Deletion left flank: AGTTGCTGGACAAAACAGCCGTGAGGAAGC. Deletion right flank: GGATACTTGAAATAAAAGGGAGCAGGAATC. Insertion Sequence: TTGAAATAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC311 C. elegans unc-47(gk192) III. Show Description
T20G5.6. Unc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3113 C. elegans tax-4(ok3771) III. Show Description
ZC84.2. External left primer: GCGGTTCGGATACGAAAATA. External right primer: GTGCCTGCAAGGAGACCTAC. Internal left primer: GCAAATTATACACAGGATCCATCTAC. Internal right primer: CCTGCTCCAAAAGTAAGCCA. Internal WT amplicon: 1290 bp. Deletion size: 442 bp. Deletion left flank: ACTTGGGATGGTCGAAATATTGGCATTTTC. Deletion right flank: AGAGCTTACCCGAGTGAGTTTTTAGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3119 C. elegans +/mT1 II; C07A9.4(ok3733)/mT1 [dpy-10(e128)] III. Show Description
C07A9.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3733 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGCGATGTTTGAAAACGAA. External right primer: TTTCGGGTTGCCGAATAATA. Internal left primer: TCTTCTATTGGCAATGCAACC. Internal right primer: CTGTGAAGGTGGTGGTTACG. Internal WT amplicon: 1278 bp. Deletion size: 537 bp. Deletion left flank: CAAAATGCCAAAAATGCTAGAGCAACAAGA. Deletion right flank: ATAACACCAACATGTAGATGACCCCGGTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC312 C. elegans +/mT1 II; sel-8(ok387)/mT1 [dpy-10(e128)] III. Show Description
C32A3.1. Heterozygotes are WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous ok387 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3124 C. elegans Y74C9A.3(gk3247) I; C03C10.2(gk3027) III; gkDf34 V. Show Description
This strain is homozygous for a deletion (gk3027) in C03C10.2, detectable by PCR using the following primers. External left primer: ACTACCGTGCTCTTGGCACT. External right primer: TCAACCTCACCCCATTTCTC. Internal left primer: GCATGTGTCTACCATCCACG. Internal right primer: GCAGTGATTTCGGGCTGTAT. Internal WT amplicon: 2385 bp. Deletion size: 826 bp. Deletion left flank: ATGCATTGAAAGATATTCATGATATGGGAT. Deletion right flank: TCAAAACCGAATCCGGTGTATGCATTCCAT. Validation: gk3027 passed by CGH. Other deletions (gk3247, gkDf34) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3126 C. elegans F42A10.3(gk3185) III. Show Description
This strain is homozygous for a deletion (gk3185) in F42A10.3, detectable by PCR using the following primers. External left primer: ATCAAATCTGGTGCCATTCAG. External right primer: AAACAAACATGTGAAAAGCGG. Internal left primer: GGGAAGTGAACACTGATTGTGA. Internal right primer: TTTCTAGAACTTTCGATCCCGA. Internal WT amplicon: 1235 bp. Deletion size: 839 bp. Deletion left flank: GGGAAGTGAACACTGATTGTGAAGAGATAT. Deletion right flank: GTCTGATGTTTATACTCTCTCCCTTGGATT. Insertion Sequence: TTGAAGA. Validation: gk3185 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3131 C. elegans Y53G8AR.6(gk3515) III. Show Description
Homozygous viable, carrying a deletion in Y53G8AR.6. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3133 C. elegans hlh-33(gk3285) III; gkDf32 X. Show Description
This strain is homozygous for a deletion (gk3285) in Y39A3CR.6, detectable by PCR using the following primers. External left primer: TGCATTTTCCAAAAGTTTAAATCA. External right primer: ACGACATTTTGTTTACAAGGAACA. Internal left primer: TCGATCAAAAACTTGGACAGC. Internal right primer: AGTGTGCATTTGATTGTCACG. Internal WT amplicon: 1494 bp. Deletion size: 353 bp. Deletion left flank: AACCACCGCTGCTCTCCGACCCGCTCGTCC. Deletion right flank: TTAGAAAAAATGGGAAAAAAAATTCTCAAA. Validation: gk3285 passed by CGH. Other deletion (gkDf32) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC315 C. elegans +/eT1 III; mrck-1(ok586)/eT1 V. Show Description
K08B12.5. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok586 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807