VC1477 |
C. elegans |
mab-5(gk670) III. Show Description
C08C3.3. External left primer: TACTGGTTGCGAGATTGCTG. External right primer: TTCATGCTCCTCCCAATTTC. Internal left primer: GTTCCTGTCTTCAAGGCGAC. Internal right primer: ATTCACACGTTGTTCGCATC. Internal WT amplicon: 2178 bp. Deletion size: 920 bp. Deletion left flank: AAAAACCTGTGAGAAATTTACAACAATTGA. Deletion right flank: TGCTCATTTGCCGACGGATTGAGTTGAGGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1478 |
C. elegans |
vpr-1(tm1411) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F33D11.11. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1411 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTCCGAGATAATACGGCGA. External right primer: ACGCTTGCCTCTAGGCACTA. Internal left primer: TTGGGGGAACGGGGAACCAT. Internal right primer: TAGGCACTAAGCACTGGCCA. Internal WT amplicon: 1799 bp. Deletion size: 657 bp. Deletion left flank: CCTCGTTCCTAACCGCAAAGGTTTTTGTAT. Deletion right flank: TGTTTTTTTTCTATTGGTATTTACGTACAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1497 |
C. elegans |
fum-1(ok1998) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
H14A12.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP ok1998 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. External left primer: ACTTGTGCGGGAGAAGAGAA. External right primer: CGAATTAAGCTTTCAAGGCG. Internal left primer: GAACCATGCCGAGTTTGATT. Internal right primer: TGAACATTTGGGGACATTGA. Internal WT amplicon: 2152 bp. Deletion size: 1351 bp. Deletion left flank: ACTTTCGGAGAGCTCGAGGTTCCAGCCGAC. Deletion right flank: TGCTCACAAGAACGGCACCACCCTTGTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1507 |
C. elegans |
kbp-4&par-2(ok1890)/sC1 [dpy-1(s2170)] III. Show Description
Y92C3B.1, F58B6.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1890 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACCCCTCACCTCGACTT. External right primer: AAAAATTGGAAAAATCCGGG. Internal left primer: CGAAGGGAAAATGCAGGATA. Internal right primer: TAAAAATCGGCAGAAATCGG. Internal WT amplicon: 2138 bp. Deletion size: 898 bp. Deletion left flank: AGGATAATTTTTTTTTTGTTGGGAAATTTA. Deletion right flank: TACGGGCTTCGCAGAGCGATTTATCGATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1514 |
C. elegans |
T23G5.3(ok2019) III. Show Description
T23G5.3. Superficially wild type. External left primer: TCTTGTGCAAGTTCGAAACG. External right primer: AATTGAAAAGGGTGTGCGTC. Internal left primer: GTACATCTTCCTTTCGCCCA. Internal right primer: TAACCTTCCCCAAGATTCCC. Internal WT amplicon: 2170 bp. Deletion size: 683 bp. Deletion left flank: TTAATTTTATAATTCTATAGATATTCTACT. Deletion right flank: TCAAATTTTCCCAATCTACCGTAACCCCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1518 |
C. elegans |
atf-7(gk715) III. Show Description
C07G2.2. External left primer: CAAGAAGGGACGGAAATTCA. External right primer: AATATTTGCAGGTGGTTCGC. Internal left primer: GCTGTGGAGCTCGAAGAGTT. Internal right primer: CCACTGTTTCTCCACCCATT. Internal WT amplicon: 1805 bp. Deletion size: 1197 bp. Deletion left flank: ATTCCTCTAGTATTCCATAAATCTTGACAT. Deletion right flank: AGAAAAACAAACAAAAAGCTTACCTCTGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1519 |
C. elegans |
gei-8(gk693) III. Show Description
C14B9.6. External left primer: CCCTCTCATTGTTCGTTCGT. External right primer: TTTTCGGGCAACAACTTTTC. Internal left primer: ATTTCATTGCGTGCATGTGT. Internal right primer: TAACTGTCAGCGTCTCGTCG. Internal WT amplicon: 1595 bp. Deletion size: 1018 bp. Deletion left flank: CGCCAATGACAACGAAGAAAATAAACTGAA. Deletion right flank: ATGAAAATCAAGGAGACGTCAGAGCAGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1521 |
C. elegans |
dyf-2(gk678) III. Show Description
ZK520.3. External left primer: GAGGTCGCTCCACTCTCAAC. External right primer: CAGCAGACGCACTCACATTT. Internal left primer: CGGCAATCGCTAGTACATCA. Internal right primer: TCGATGTCGGCTGTGTATTC. Internal WT amplicon: 1671 bp. Deletion size: 202 bp. Deletion left flank: TGCCCATTTGGTCTCCATCGATGAATAATC. Deletion right flank: AAAAAATGAAGTACAAATCATTGAGCTACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1530 |
C. elegans |
mei-1(ok2000) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T01G9.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2000 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATTGTTTGTCGCGGATGA. External right primer: GATGAAGGTGGCCTTGAAAA. Internal left primer: TGTTTCCAACAAGTGAGCCA. Internal right primer: CAAAAACCAAAGCTAGGCCA. Internal WT amplicon: 2180 bp. Deletion size: 1378 bp. Deletion left flank: ACAAAGAAAGGAGTTGGAGCAGCAGGTCCA. Deletion right flank: CAAAGAATGGTGTGACTCTTTTGGTGCCAT. Insertion Sequence: TGTAAATCAACTATTTATTGTGATCTCCTTTTAGTTTAAAATATTGTGGCCTAGCTTTG GGTTTTTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1531 |
C. elegans |
Y37D8A.2(gk704) III. Show Description
Y37D8A.2. External left primer: TATTGGCCTTGAGAACACCC. External right primer: CTCTTCGTCAGTTTTTCGGC. Internal left primer: TTGAAAGCGCGAAACAATTT. Internal right primer: CTTCAGGCTTCTGGCAAACT. Internal WT amplicon: 1789 bp. Deletion size: 306 bp. Deletion left flank: ATGATTTTTTGAAAATTAAAAAAAAACCAG. Deletion right flank: TTTTGCCTTTTTCTTCAAAATCCAAGCAAA. Insertion Sequence: CC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1533 |
C. elegans |
T23D8.3(ok2016) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T23D8.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2016 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGAAGAGCAAGAAGGCGA. External right primer: GGCGCCAATACTTGTTGAAT. Internal left primer: ACACAATTGAGTCGAAGGGG. Internal right primer: CCGGTTCTGTCCAATCAGTT. Internal WT amplicon: 3212 bp. Deletion size: 1434 bp. Deletion left flank: AGGGAATATAAGGAATATTTTGAGACGGGT. Deletion right flank: ATAATTTTCTTGAAGTTTATTTTTCATAAA. Insertion Sequence: ATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1537 |
C. elegans |
isw-1(ok1951) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F37A4.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1951 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTGCTCGATCACGTCAAAC. External right primer: AGAAATCCGGCAAGCATCTA. Internal left primer: TACAGCTTGCCGGAAAAATC. Internal right primer: TAAACGCCCGAGGTAATTTG. Internal WT amplicon: 2817 bp. Deletion size: 1866 bp. Deletion left flank: TTTCTGGGCTTCCGACATACGACCTTGTTG. Deletion right flank: GCGGCGTCGGACGATTCCGGTTCATCGTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1539 |
C. elegans |
hpd-1(ok1955) III. Show Description
T21C12.2. Superficially wild type. External left primer: TTGTGGCTGTGCACATTTTT. External right primer: AACATCCCCGTAGCCATTCT. Internal left primer: CGGCAATTTGTCAAAAATCA. Internal right primer: AAAACAGGAAACCGTTGTGG. Internal WT amplicon: 2256 bp. Deletion size: 1363 bp. Deletion left flank: TAATTCAGAACTCGGAAATCACCTTGTTCA. Deletion right flank: GCCCGTGGCTGTGAATTCCTTTCCATTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1549 |
C. elegans |
pfd-5(gk706) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R151.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk706 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGGAACTGGTGCTTTTTCG. External right primer: ACATTGCAGGGAAACAAAGG. Internal left primer: ATAGCAGCGAGACAAGCACA. Internal right primer: TTGAATTACCGCCAACAGTG. Internal WT amplicon: 1648 bp. Deletion size: 587 bp. Deletion left flank: TCGCAGTTTGTCACCGGTTGAACTCTCATT. Deletion right flank: CCTGCAGTTGCAATTTTCACATCGTCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1560 |
C. elegans |
cnd-1(gk718) III. Show Description
C34E10.7. Unc, sometimes with rounded nose. External left primer: GTTGCGGACAACACACATTC. External right primer: CATGTTAATCGGTGACACGC. Internal left primer: ACGTACTCGATATCTCGCCG. Internal right primer: GTGGAACACCATTCCACACA. Internal WT amplicon: 2138 bp. Deletion size: 1438 bp. Deletion left flank: TACTCGATATCTCGCCGCGATCGTACCGTA. Deletion right flank: TACTCTCTGAGCATATCCAATGCATTATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1575 |
C. elegans |
cgh-1(ok492) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C07H6.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok492 homozygotes (sterile adult, tends to explode at vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCAGCTCGAAAATATTGCC. External right primer: GGAAAACCGCAAGGATGGTGG. Internal left primer: TCACGGAGCTAGATGTGACG. Internal right primer: CGTCAAAAAGAACCCGATGT. Internal WT amplicon: 3095 bp. Deletion size: 1043 bp. Deletion left flank: GAGAACATACACAATCTGGACGAGATCACT. Deletion right flank: CCTGGGGTGGCGATGACCAAGTGAACCGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1582 |
C. elegans |
R10F2.5(gk699) III. Show Description
R10F2.5. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 581 bp. Deletion left flank: CGGGGAGAAGAGTTATCAAAAAGTTGTAAA. Deletion right flank: TGTATTTACGGGAGTCTGTGTGGGCTTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1583 |
C. elegans |
cdh-1(gk747) III. Show Description
R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 1004 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGTAGAAGGGCCCTGATGTGTGTGTGTGTGTG TGTGTGTGTGTGTGTGTGTGTGTGTG. Deletion right flank: AGAGTTTGGGCTTATTTTTTGAAATTTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1598 |
C. elegans |
acr-20(ok1849)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
R06A4.10. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1849 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGTCTTTTGGATGACACCG. External right primer: CCGCCAAATTACCTACCAAA. Internal left primer: TACTGTATCCGGAGCCATCC. Internal right primer: TGGGTGGTTGACCAATTTCT. Internal WT amplicon: 3238 bp. Deletion size: 1398 bp. Deletion left flank: CCATCCACCAGTAGAAAAAACCAATCAGAT. Deletion right flank: GATCAGAATAATACAATCCTAACTGTTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC160 |
C. elegans |
trp-1(ok323) III. Show Description
ZC21.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1609 |
C. elegans |
kin-10(ok2031) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T01G9.6. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2031 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCGCAAAATTTCACGTTT. External right primer: TTCGACAGAAAACTGCTGGA. Internal left primer: GTGACGAAGACAGGCACAAA. Internal right primer: TTCACCCAACCTGTACCCAT. Internal WT amplicon: 2149 bp. Deletion size: 966 bp. Deletion left flank: AGTCGTGTTGTTTTGTGCTGCGGCAACGTT. Deletion right flank: TGGAAGCATTGGCTGATTTTCACAGTAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC161 |
C. elegans |
mtm-6(ok330) III. Show Description
F53A2.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1610 |
C. elegans |
T08B2.5(gk721) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T08B2.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk721 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATTTGGTTGAGACGATCCG. External right primer: AAGGTAACATCGCCATCGAC. Internal left primer: CGTGACATGAGATCAGGCAT. Internal right primer: GCTTGTCAAACCTCACGGAT. Internal WT amplicon: 2344 bp. Deletion size: 914 bp. Deletion left flank: GGAATTGTCTACAGTGGATGTATGAACACT. Deletion right flank: GGTTGCCATCAAATTCAAATTTCCAGGGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1611 |
C. elegans |
+/mT1 II; vab-7(gk709)/mT1 [dpy-10(e128)] III. Show Description
M142.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk709 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTTCCCCTCTTCTATTGGC. External right primer: CGACACGCAACACCAATTAC. Internal left primer: AATCCACCGTAGTCACCGAG. Internal right primer: TCAGAGCATGTTTCCCAGTG. Internal WT amplicon: 2427 bp. Deletion size: 1019 bp. Deletion left flank: TAAATTTTTGTAGTTTTTTAGGGATTTTTT. Deletion right flank: TCACTTGTGGAGATGGTCGCCGCATCTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1613 |
C. elegans |
T15B12.1(gk751) III. Show Description
T15B12.1. External left primer: AAAAATTGCCAGAATCGTCG. External right primer: CAAAGGCGGTTTGTGAAAAT. Internal left primer: ATTGGCAATCTCCGTTCATC. Internal right primer: GTTAACAGCCAGATGCTCCC. Internal WT amplicon: 1544 bp. Deletion size: 622 bp. Deletion left flank: TGTGTTCTTTTGATTAATTGATATGCATTC. Deletion right flank: ACACTTCCAAATCGTCCAAATATCGGAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1618 |
C. elegans |
Y71H2AM.3(ok2025)/sC1 III. Show Description
Y71H2AM.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2025 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGTCATGTTTTTCCGGTGA. External right primer: TCTCGCTTCACGTTTTTGTG. Internal left primer: TTTTATTCGCATTTCCTCCG. Internal right primer: TCGGCTTTCTCCTCATGTTT. Internal WT amplicon: 2726 bp. Deletion size: 1372 bp. Deletion left flank: CACAAGTGGCTCACCGACTAAAAAATCGAG. Deletion right flank: ACTATTCAATGTCTTCCAGATGATGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1621 |
C. elegans |
T26G10.1(ok2057) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T26G10.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2057 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCACCATCAGCAATATCCA. External right primer: TCCGTTGGACTTTCCAATTC. Internal left primer: TTTTGTCGTCGCTTCTTTCC. Internal right primer: AAGTGTCGTCAGATTGCGTG. Internal WT amplicon: 2101 bp. Deletion size: 1183 bp. Deletion left flank: AGTCGGAAAATTCAAAATCTAACCTAAATT. Deletion right flank: CTCTGAAGACAATTAACCAGTTATTTCAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1622 |
C. elegans |
let-765(ok2058) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F20H11.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2058 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAATCGTATTGCTGCTTCCA. External right primer: CGGAGCTGGTGTAGGAAAAG. Internal left primer: GTCCATTCGAATCTTTCCGA. Internal right primer: TGCTGAACGTGATCTTCGAG. Internal WT amplicon: 3229 bp. Deletion size: 1540 bp. Deletion left flank: CACAGATTCTAGATGAAGTGATAAAATCCG. Deletion right flank: TTTTGAAGTTCTAAGACCATTCGTCCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1623 |
C. elegans |
set-3(ok2114) III. Show Description
C07A9.7. Superficially wild type. External left primer: TTGACGAGTTTGACGACGAG. External right primer: TTGTGGATGTCATGGTTGCT. Internal left primer: TTAATTTCGCTGATTTCGCC. Internal right primer: CAGAATGGTGGAAGTTCCGT. Internal WT amplicon: 3109 bp. Deletion size: 2295 bp. Deletion left flank: AAATTTTCAATTAATTTCGCTGATTTCGCC. Deletion right flank: TTTTTTGTGAACGCGAAAAGGTGTGCGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1624 |
C. elegans |
F54H12.5&F54H12.6(ok2133) III. Show Description
F54H12.6, F54H12.5. Superficially wild type. External left primer: TTGGATGGTCTTCTTCTGGG. External right primer: CGAAAATGAATGGGAGGAGA. Internal left primer: TGGAGTGGAAATTTCTTCCG. Internal right primer: CATGGGGTTTCGACAGACTT. Internal WT amplicon: 2179 bp. Deletion size: 1993 bp. Deletion left flank: AACCACGGTAACGGTCTCGACACGACAAGT. Deletion right flank: CTTTTCAGGAGTGAAACACGAAGGAATGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1632 |
C. elegans |
C17E4.6(gk787) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C17E4.6. Maternal effect lethal/sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk787 homozygotes (fertile WT whose progeny arrest before reproducing). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTGTGTGAAGAGACGCAGA. External right primer: CCAACCCCAACTGCCTACTA. Internal left primer: AGAGCGCGTTTGCACTAATC. Internal right primer: GGAGCCATAGTCGAGAGACG. Internal WT amplicon: 2178 bp. Deletion size: 796 bp. Deletion left flank: AGAAGGAAGCTCCAATGACGAACATTCAAA. Deletion right flank: ACTGTTTTTGAAGAAACGTTTAAAAAAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1633 |
C. elegans |
unc-120(gk719) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
D1081.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk719 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACTACCTTCACCCCTCCAA. External right primer: CTATAACACGGGACCCCCTT. Internal left primer: GGTCCTTCCATTCCCATCTT. Internal right primer: GGCTGACATAACATCGCTCA. Internal WT amplicon: 2150 bp. Deletion size: 972 bp. Deletion left flank: ATGTTTCTAAAATTTATCTGCATTTTCATA. Deletion right flank: AAATATCCTGACTCACCTATTTAGTTGCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1635 |
C. elegans |
nono-1(gk1206) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F25B5.7. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1206 homozygotes (Unc, nearly Ste, has a few progeny but can't maintain population). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCCCGTGACGAGATATCAG. External right primer: TCAAATTGCAACTCAACCCA. Internal left primer: AATCGGGAATTGGACACAAC. Internal right primer: TCGCATTATATCGCAGCTTG. Internal WT amplicon: 2308 bp. Deletion size: 1026 bp. Deletion left flank: ACTTCACAAATCAGTGGTTTCGGACTCCTA. Deletion right flank: AAAAGAAAACTCTAGAAGCTTCATAAATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1638 |
C. elegans |
ZK1025.4(ok2101) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK1025.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2101 homozygotes (sterile, lays unfertilized eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTGCTGTTCGGGAAAAAT. External right primer: CAACTTTCCGGCTTGTAGGA. Internal left primer: TTTCCGGGTGAGTGAGTTTC. Internal right primer: GCGTCCGTGAAATTTGAGAT. Internal WT amplicon: 3284 bp. Deletion size: 1617 bp. Deletion left flank: TAAGCTTGGCGTCAGAGGCGAGCGTTAGCT. Deletion right flank: TTTCCGCCAGATCGGCAAATTTGCCGGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC164 |
C. elegans |
swd-3.1 dph-1(ok329) III. Show Description
C14B1.4, C14B1.5. Slow-growing, small broods. Deletion removes 3' end of C14B1.4, 5' end of C14B1.5. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1644 |
C. elegans |
cnd-1(gk781) III. Show Description
C34E10.7. External left primer: GTTGCGGACAACACACATTC. External right primer: CATGTTAATCGGTGACACGC. Internal left primer: ACGTACTCGATATCTCGCCG. Internal right primer: GTGGAACACCATTCCACACA. Internal WT amplicon: 2138 bp. Deletion size: 1176 bp. Deletion left flank: ACGAGGTTGGACCTGGAAAAGAGAGGGGAT. Deletion right flank: GTTCGTTGGGAAGGATGGAATGGTTTCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1657 |
C. elegans |
uaf-1(gk800) III. Show Description
Y92C3B.2. External left primer: ACCGGTTACTGTAGGCATCG. External right primer: TCGGTGATTTTGGTGTGAAA. Internal left primer: AGCGTTATTTGCTGCGATTT. Internal right primer: TCACAGGAGCACATTTGACC. Internal WT amplicon: 1809 bp. Deletion size: 737 bp. Deletion left flank: GTTTTGCCATGAAAAAGTGCAAATTTAGGT. Deletion right flank: TCAATTTTTCGCTCTAAAATCGAATTTCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1658 |
C. elegans |
cdh-1(gk784) III. Show Description
R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 579 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGT. Deletion right flank: TTGGGGGTAGATTTACTGAGGATATTGTAG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC167 |
C. elegans |
tbb-2(gk130) III. Show Description
C36E8.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1670 |
C. elegans |
gpr-1(ok2126) III. Show Description
F22B7.13. External left primer: TAGAAGTTGAGTGCGCGAGA. External right primer: ACAGATCGATGAATGAGCCC. Internal left primer: TCGTGTATTCGTGGAGATCG. Internal right primer: TCTTTTTCGGGAAACAATGC. Internal WT amplicon: 2127 bp. Deletion size: 895 bp. Deletion left flank: GAAATGCTTGTCACTAGACGAAAAATACGA. Deletion right flank: ATCCTCCCTGGACTCCGTGCCAATTGGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1676 |
C. elegans |
Y71H2AM.12(ok1989) III. Show Description
Y71H2AM.12. Superficially wild type. External left primer: GCGAAAAAGGTAACTGCTGG. External right primer: GTTGAGGCCCAAAAATCAAA. Internal left primer: ATGCAGCACCTCCTCGTAAC. Internal right primer: GTTGTGGTTGTTGGGGAATC. Internal WT amplicon: 2336 bp. Deletion size: 1365 bp. Deletion left flank: AATTTCCTGTCACGTACTCATTGCACCACA. Deletion right flank: TCGATTATTCCCTTCCATCGGATCAAATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1684 |
C. elegans |
C34B2.8(ok2168) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C34B2.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2168 homozygotes (mid-larval arrest, thin Unc sometimes with withered tail). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTTTCATTCCACCTTCGGA. External right primer: CATCTGCTCCAACGACTTCA. Internal left primer: AACAACCGCGTCAAAAGTGT. Internal right primer: ATTCGTCTCGATTTGCTGCT. Internal WT amplicon: 2130 bp. Deletion size: 1250 bp. Deletion left flank: GACCCACCGCTCAATTTTTGTTCCTGCGCC. Deletion right flank: TTGAATGCACGATAGCCTCCTTTTGGAGGC. Insertion Sequence: AAAAGTGCGATGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1685 |
C. elegans |
cogc-1(ok2123) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y54E10A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2123 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAATTCGCCAAAAGGGTCT. External right primer: AGCAGAAGCTGGAGCACATT. Internal left primer: CTGACAATTTTTGGGCTCGT. Internal right primer: GCCATCGTTTCTTTGAGAGC. Internal WT amplicon: 3367 bp. Deletion size: approximately 1600 bp. Deletion extents narrowed to region between Y54E10A coordinates 80020 and 81877. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC169 |
C. elegans |
tbb-2(gk129) III. Show Description
C36E8.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1701 |
C. elegans |
mif-1(gk1027) III. Show Description
Y56A3A.3. External left primer: TAAAGCACAAATCCCGGAAG. External right primer: GTTTGACCGTTGTAGGCGAT. Internal left primer: ATGTGCAGCAGAAAGGGAAG. Internal right primer: TTGTCGAATCACACAGGAGG. Internal WT amplicon: 2124 bp. Deletion size: 1620 bp. Deletion left flank: AAAAAAGAGGACGAAAAAAAAGTTTTGAAT. Deletion right flank: AGTAAAAGAATGATGAATTTCTTTTCCGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1706 |
C. elegans |
C38H2.2(ok2175) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C38H2.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2175 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGTGCTGGTGATATGGCAA. External right primer: GAAAAGGCACAGGGTGTGAT. Internal left primer: TCAGACAACCTACGACGCTG. Internal right primer: AGGGTGGAGAACAGTCATGG. Internal WT amplicon: 2946 bp. Deletion size: 767 bp. Deletion left flank: GCGAAGAAGGTTCGCGTCTTCTGTTGGATT. Deletion right flank: GGTAATTTCAGATTCATTGAAGTAGCGCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC173 |
C. elegans |
+/eT1 III; gck-1(gk137)/eT1 V. Show Description
T19A5.2. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk137 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1730 |
C. elegans |
C36B1.8(ok2141) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C36B1.8. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2141 homozygotes (often sterile or nearly sterile, but a population can be maintained and will starve a plate). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAGGACGGCTGTTCCTAAA. External right primer: CATATTGAGCTGGAGTCGCA. Internal left primer: CGAGTACAGAACCGAGGAGG. Internal right primer: ACAATACGCTCTCCGTTTGG. Internal WT amplicon: 3357 bp. Deletion size: 1835 bp. Deletion left flank: TTCTAGCATCTAAATTTTAACAATTAGATT. Deletion right flank: AAATGTATTTTACAACACAATTTCCCTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1732 |
C. elegans |
let-526(gk816) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C01G8.9. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk816 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. (Note: in this strain hT2[qIs48] occasionally recombines such that the GFP and its associated lethality are lost and the non-GFP hT2 left behind still carries the bli-4 mutation of the original hT2. Such a recombination event results in a viable non-GFP animal that is no longer gk816/hT2[qIs48] but is gk816/hT2.) External left primer: GCCATCACTTTCATCGGATT. External right primer: AATAGACGGCACGTGGAAAC. Internal left primer: ATTCGTTGTTGATAAGCCGC. Internal right primer: ATGACCGATGATGATGACGA. Internal WT amplicon: 1843 bp. Deletion size: 1268 bp. Deletion left flank: AGACATAGACGTCATGCGAAAAATAATATA. Deletion right flank: TCTATATATTCTCCGCGTGGTGGGCTATTT. Insertion Sequence: TATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1733 |
C. elegans |
nekl-2(gk839) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZC581.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk839 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGCCCTCTAAATTGTCA. External right primer: GCAGATTTCGTTCCAAGCTC. Internal left primer: TCTTTGTTAGCCATTTCCGC. Internal right primer: GAACAGTCTTTCGGCGATTC. Internal WT amplicon: 1654 bp. Deletion size: 506 bp. Deletion left flank: ATTTCTTGCCGTTTCGTTGAAATTGTTAAC. Deletion right flank: TGTGTTATAATCTACTAACTTTATAATTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|