More Fields
Strain Species Genotype
VC2255 C. elegans atp-2(ok3002) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C34E10.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3002 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGCCACCAAGGTTTGTAT. External right primer: CGGTAAGCTTGTCTTCCTCG. Internal left primer: AGGTCTCTGCCAAGGCTACA. Internal right primer: TTTGAACTCCACGAGCAATG. Internal WT amplicon: 1178 bp. Deletion size: 500 bp. Deletion left flank: CAAGGCTACAGCTGCTAACGCTTCCGGACG. Deletion right flank: GTTACTCTGTGTTCGCTGGAGTCGGAGAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC226 C. elegans ida-1(ok409) III. Show Description
B0244.2. Slow-growing, and some animals appear sterile or Egl. Tail defects are common, and hermaphrodites can be mistaken for males in extreme cases. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2263 C. elegans Y47D3B.6(ok3027) III. Show Description
Y47D3B.6. External left primer: CCTCCAAACAAGGCAACATT. External right primer: TGATTTTTCTTGAAAGCCCG. Internal left primer: CCATTGCGATTCACACTCAG. Internal right primer: TTGGGTTTTGTTTTGGGG. Internal WT amplicon: 1120 bp. Deletion size: 558 bp. Deletion left flank: GATGATGGCTCCACCAGCACCACTCCCAGC. Deletion right flank: AGTCTGCCAGTGCGCCGGAGCCTACGAGCC. Insertion Sequence: CTCCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2270 C. elegans lap-1(ok2917) III. Show Description
ZK353.6. External left primer: GATGTGTGTGGTCAGCTCGT. External right primer: ACCAACGAGGATGCAGTTTT. Internal left primer: CGGGACAATTACTGTTTGAGC. Internal right primer: ATCTCTCAGAATCGGTCCGT. Internal WT amplicon: 1129 bp. Deletion size: 331 bp. Deletion left flank: ATTGAATTGAAGTTAAATATACTTTGCAAT. Deletion right flank: CCAGCCTTCAACAGTTCTTCCCCACGGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2272 C. elegans rsp-3(ok2927) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y111B2A.18. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2927 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGGGCTGATGAATACTTGGA. External right primer: CGTGGCACACTCATTTCTTG. Internal left primer: GGTTGTTTGAATTAAGGATAGGTGA. Internal right primer: TTGAAGGATTTTAGGCCCAG. Internal WT amplicon: 1226 bp. Deletion size: 632 bp. Deletion left flank: GTTTCAAAAATAGTAAAAACTCACCTCATG. Deletion right flank: ATTATTTGCAAAAAATCGGCGACTGAAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2277 C. elegans F56D2.6(ok2951) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F56D2.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2951 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGTCCATAACACGCGACAAT. External right primer: CAGCGAACGAACTGTTCTCA. Internal left primer: GACTGTGTCGGCAGTTTTCA. Internal right primer: CCCGCTCCTCGATAAGTACA. Internal WT amplicon: 1289 bp. Deletion size: 1018 bp. Deletion left flank: AATGATAGACATTGAGAAGTGTGAGATGAT. Deletion right flank: TCGATTTCTCACGATTTCCTTGATCAGTCC. Insertion Sequence: TTCCATCAATATGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2278 C. elegans F25H2.4(ok2171)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F25H2.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2171 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATTTTGGAAGACACGACGG. External right primer: ATTGCTTATGTCTCCCGGTG. Internal left primer: AAATATCGCGTTTTTGCTGG. Internal right primer: TCATGGCAACCAATCCTACA. Internal WT amplicon: 3179 bp. Deletion size: 1448 bp. Deletion left flank: CATACTTTTTGTTATTATACTGGCTGCTCT. Deletion right flank: CCAAAGACAGTCGTCTTTAATACCAATTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2279 C. elegans cct-6(ok2904) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F01F1.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2904 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAGTTGGGCTTGTTGAACG. External right primer: CCCTCGAGTTGCTTGAAAAG. Internal left primer: ATTCTGGTTGTGGCTGCTTC. Internal right primer: GCGTGACCTCCTTGTAGAGG. Internal WT amplicon: 1286 bp. Deletion size: 605 bp. Deletion left flank: CCGAGCTTGGCACGTCCCTTCAGGTTCTCA. Deletion right flank: CTTCAGTCTTCTCGTATTCCAAAGAAACGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2281 C. elegans T08G11.4(ok2909) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T08G11.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2909 homozygotes (early to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGATTTCCATGCGACTTTTT. External right primer: GAAATTTGTCGCAAATCGGT. Internal left primer: CTCGACGAGCTGAAAAATGT. Internal right primer: ACGGAGTCGCTTCTTTTCTG. Internal WT amplicon: 1281 bp. Deletion size: 505 bp. Deletion left flank: CAAATGAGACTAATGATGTTCTAAGTATAT. Deletion right flank: CAGTGAATGCATCGACAACAACAGAAACAT. Insertion Sequence: AT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2291 C. elegans asg-1(ok2950) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K07A12.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2950 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGCAGTTCTCTCGCTTTTT. External right primer: ATAAGCCAGGATGATGCGAC. Internal left primer: GTAATCCGGATCTTGCTTGG. Internal right primer: ACACTCGAGAGGCTGGAGAA. Internal WT amplicon: 1204 bp. Deletion size: approximately 1203 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2292 C. elegans unc-55(ok2822) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F55D12.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2822 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGACATGTCGGTTGGGATT. External right primer: GCCGAGAATGAGGAATTCAA. Internal left primer: GAGACGGGGGCATACTGTAG. Internal right primer: ACCACGTGGATTTTCATTCG. Internal WT amplicon: 1112 bp. Deletion size: 492 bp. Deletion left flank: ATCAAGGAGACGGGGGCATACTGTAGGTCA. Deletion right flank: AAACCTTATGTCAAAATTTTTTTTCTGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2293 C. elegans B0511.6(ok2948) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0511.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2948 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTGTCTTTTCCCTTCTGG. External right primer: CGTTCATTTCCGGTCTTTGT. Internal left primer: TCATAAAATTTGTTAATTTTGCAGG. Internal right primer: CCAATGAACGAAACAACGTG. Internal WT amplicon: 1363 bp. Deletion size: 577 bp. Deletion left flank: TGGACGACTTTTGGATCATCTTCAGAATAC. Deletion right flank: ACAACTCGCGGAAATGTTTTTTATTTAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2306 C. elegans R151.8(gk1063) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R151.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1063 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGTGGTCTTCTTCTTCTG. External right primer: AGTTCTTCTCGACGACGCAT. Internal left primer: GAGATGCATGTCGTGTCGAT. Internal right primer: ATTGTTTCAGCACGGGAAAG. Internal WT amplicon: 2188 bp. Deletion size: 308 bp. Deletion left flank: AGGTGGTGTTTTAATCGTTACCAATTTCCT. Deletion right flank: GTGATCTTTGGTCTTTTCCATTTTTCGCTT. Insertion Sequence: GATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2307 C. elegans K01G5.5(ok2795) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K01G5.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2795 homozygotes (early larval arrest, Dpy or Dpyish). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAACTTCCATCCTCGAAC. External right primer: CCTCCTCCTCTTCCTCGTCT. Internal left primer: CGCACCAATCACTACACACC. Internal right primer: GGCGTCTCCTCTTTCTTGAC. Internal WT amplicon: 1149 bp. Deletion size: 997 bp. Deletion left flank: GGGAGTATCACCATTAAAGCGTGACATCAA. Deletion right flank: ATTCGGAAAACCAAATGACACTACTCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2311 C. elegans inx-15(ok2377) bli-4(ok3478) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R12E2.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Deletion chromosome appears to carry a second-site mutation in bli-4. Heterozygotes are Bli with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2377 homozygotes (early larval arrest, Dpy). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick Bli GFP and check for correct segregation of progeny to maintain. External left primer: AACAAGCCACACCGATAAGG. External right primer: GCAGACAAAAGGACCTGCAT. Internal left primer: TCGATGTTCGGAATACGATG. Internal right primer: TTTTAGATTATTTCAAAAGCGCA. Internal WT amplicon: 3163 bp. Deletion size: 1297 bp. Deletion left flank: CGAAGCATGGAAGAAATGTTGGAAAGACGT. Deletion right flank: AAGTCATATATTGTTTGATATCAATTATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2312 C. elegans let-363(ok3018) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0261.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3018 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCCGCTCCAGCTACAAAT. External right primer: ATCGAGCTTTGCTGTTTCGT. Internal left primer: AGGGATTGATGCTGCAAGAG. Internal right primer: TTCGGAAATCGTTCCAAAAC. Internal WT amplicon: 1186 bp. Deletion size: 664 bp. Deletion left flank: GAGCCGGTATCTATCTCATCGTGTGCTTAG. Deletion right flank: ATTCGAACTCATCAGATGTGAATCCTCACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2326 C. elegans C06E1.8(gk1061) III. Show Description
C06E1.8. External left primer: CCCGCAAACAGGAAGAAATA. External right primer: CTGCTGCTCCAAAACATTGA. Internal left primer: GCACAGTTTGTTCCAATCCA. Internal right primer: TTCTTCTTCCTCCTCCGTCA. Internal WT amplicon: 2185 bp. Deletion size: 559 bp. Deletion left flank: ATTATTCAAAGTCCCCAATTCAAATACAGT. Deletion right flank: GTTTTCATTCTATTTCATATTTTTGTCTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2329 C. elegans frm-1(gk1084) I; cTe154X.1(gk3193) III; gkDf29 IV. Show Description
This strain is homozygous for a deletion (gk1084) in ZK270.2, detectable by PCR using the following primers. External left primer: AATGGTGACACGATGCTCAA. External right primer: ACACAGACACAGCAAGACGG. Internal left primer: GTTAAATTCCAGTGGCTGCG. Internal right primer: GAAGCCGATGGACAAAGAGA. Internal WT amplicon: 796 bp. Deletion size: 179 bp. Deletion left flank: ATAATTTGCTAGTCTTTTTGGAATTTTTCT. Deletion right flank: GATTTAGGTATTTTAAAGTCGACGGACAAA. Validation: gk1084 passed by diagnostic PCR. No CGH probes for gk1084. Other deletions (gk3193, gkDf29) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2330 C. elegans Y39A1C.1(ok3032) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y39A1C.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3032 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGTGGTGACTCCAAAACTT. External right primer: CTGCGTCTCCTCCTCTTCAC. Internal left primer: TTGGGTTTCCATGGTGACTT. Internal right primer: AAAAACCCGCATCTAACCAC. Internal WT amplicon: 1253 bp. Deletion size: 520 bp. Deletion left flank: CGAACCGTGGTGTCTCCAGGCGGGAATTCA. Deletion right flank: TTTTTGTAAATAAATTGAATTTTTAATATG. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2332 C. elegans pat-2(ok2148) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F54F2.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2148 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTCATCGTCTTGGATACG. External right primer: AAGTGAAGTTTGTCAGCCCG. Internal left primer: TCGTGTTTTTATTGGAGCCC. Internal right primer: CGACTATGAGATCGTGGCAA. Internal WT amplicon: 3238 bp. Deletion size: 1660 bp. Deletion left flank: CAGTTGTTGGAGATGATCAGTGGGGACGAT. Deletion right flank: TTTTATAATGAGACAAGTTCACAGCCATTT. Insertion Sequence: GTGGAGTGGAGAGATGTGGAGTGGGGAGTGGGGAGTGGGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2333 C. elegans Y34D9A.1(ok2837) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y34D9A.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2837 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCCGCAAAATCTCTTGAAAA. External right primer: AAACGGCACGTGCTTTACTC. Internal left primer: GAAATTTTCCGATTTTCTGCC. Internal right primer: TCCGAGTTTTTAAATGGCAA. Internal WT amplicon: 1222 bp. Deletion size: 475 bp. Deletion left flank: AGCTGAAAAAAATGTTTTTTTCCGGGATTT. Deletion right flank: GATTAAATCAAAAAAATAAGGAAAATATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2340 C. elegans W02D9.3(gk1128) I; rbf-1(gk3217) III; srh-145(gk3218) V. Show Description
This strain is homozygous for a deletion (gk1128) in W02D9.3, detectable by PCR using the following primers. External left primer: ACGGATTTTGCCACTTTGTC. External right primer: CATCACATTTCTCGTGGTGG. Internal left primer: TTGGAGAGGTGTGAACGTAGAA. Internal right primer: TTTCTAGGCCGTACGTTGCT. Internal WT amplicon: 1621 bp. Deletion size: 1315 bp. Note: internal left primer binding site deleted in gk1128; major deletion product from nested PCR runs at about 650 bp. Deletion left flank: GCAGAAAAAATTTTGGAATTTGAGCTACAT. Deletion right flank: CATTTTCTTGCAGAAAAACGTGCAAAATTC. Validation: gk1128 passed by CGH. Other deletions (gk3217, gk3218) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC235 C. elegans +/mT1 II; pan-1(gk142)/mT1 [dpy-10(e128)] III. Show Description
M88.6a. Heterozygotes are WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous gk142 hermaphrodites (dpyish L1 or L2 larvae). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2355 C. elegans apr-1(ok2970) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K04G2.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2970 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGATTTGTGATGGCACAGT. External right primer: GCAGCACCAGAAGTTGATGA. Internal left primer: ATGGTAACGATTTTCCAGCG. Internal right primer: TGGTTCTTCAGCAGTTAATCCA. Internal WT amplicon: 1205 bp. Deletion size: 665 bp. Deletion left flank: TCATCAATTGACGTCTCAACAGCAGAACAC. Deletion right flank: GCTCAGACTGGTCTCCACAACAACAATTAC. Insertion Sequence: AGGACACCCAGCGATCATAACGGCATTGATGTGGCAAGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2360 C. elegans ucr-2.3(ok3073) III. Show Description
T24C4.1. External left primer: CGTGCTGGTTCTCGTTATGA. External right primer: CATATGCAGAGATGGCGAGA. Internal left primer: TCACTCAGCCTGGACTTGTG. Internal right primer: TTCTGGACCGTTGTAGAGGG. Internal WT amplicon: 1135 bp. Deletion size: 415 bp. Deletion left flank: GAATTGTGTTTGAGGATATTCATCGCGCTG. Deletion right flank: CTTCTCCACTGAAATTTGCATCACTTCCAG. Insertion Sequence: TTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2372 C. elegans F14B4.3(ok1970) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F14B4.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1970 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAACAGTTGGCCCAAAA. External right primer: CCATCTCCGTGGAATGTCTC. Internal left primer: ACAAATGGCGATGCATCATA. Internal right primer: GGTGAAGAGCCAATCGAAAA. Internal WT amplicon: 3259 bp. Deletion size: 1241 bp. Deletion left flank: GAAAACTTACCGTGGTGACTGATTATGATC. Deletion right flank: ATTTACGTAGATTTAGGTGCGTCTAAGGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2380 C. elegans K10D2.4&cid-1(ok2756) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K10D2.4, K10D2.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2756 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 547 bp. Deletion left flank: TCACTTGCAAGACAGTGTGGCTATTCTGAC. Deletion right flank: AGAAACGCCACTTTTATTTATTTATCAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2381 C. elegans T16H12.1(ok2764) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T16H12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2764 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTCGCTCGATTTGTTCGTT. External right primer: TCGAGGAGCCTTTTCACATT. Internal left primer: GACGCAAATTCGAGAAGATTT. Internal right primer: TGACACTGTCGAATAAGGCG. Internal WT amplicon: 1149 bp. Deletion size: 613 bp. Deletion left flank: TCGTTCGACGCAAATTCGAGAAGATTTTGT. Deletion right flank: TTCGAAACTTTATCGAGAGAAACATTGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC240 C. elegans nex-1(gk148) III. Show Description
ZC155.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2405 C. elegans chc-1(ok2369) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T20G5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2369 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAAGACTCCGTCAATTCGT. External right primer: CGATTGGCTGCGATACTTTT. Internal left primer: CGTTTACAGCAACCACCTGA. Internal right primer: GTCTTTTGCGGAAATTCCAA. Internal WT amplicon: 3239 bp. Deletion size: 1382 bp. Deletion left flank: AAATAAAATGTGCGATTTCGCAATACCCAT. Deletion right flank: TGTTGTTCGTGAGATGGTAGGTCAAATAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2409 C. elegans mes-2(ok2480)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
R06A4.7. Homozygous maternal-effect sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2480 homozygotes (maternal-effect sterile). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGAAGTTTCGTGCTCCGTGT. External right primer: CGTCTCTTCGCATAGAACCC. Internal left primer: GTATCGAGGTTGGCGACATT. Internal right primer: CGTGCCAAGTTTCCAATTTT. Internal WT amplicon: 3364 bp. Deletion size: 1262 bp. Deletion left flank: CTATGGCCAAACAAAAGTTCACAGAGAGAA. Deletion right flank: GCCAATCACAGCGTGTCGACATGCGGGTGA. Insertion Sequence: GAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2410 C. elegans sma-4(ok3140) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R12B2.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3140 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACGGAAAGGTGTTCCACAT. External right primer: GGTCCGTGCAGAAAATCAGT. Internal left primer: CGCAAGAATATGGAGATGGC. Internal right primer: TGCTCGTACTGCTTCATTGC. Internal WT amplicon: 1288 bp. Deletion size: 718 bp. Deletion left flank: AGAGGTGGCTGCTCTCTCTCTCTGACTTTT. Deletion right flank: TTCGTCCGATCCGGGTACCTAGACTACACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2411 C. elegans Y48G1A.4(ok3096) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y48G1A.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3096 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAAACTCGCAAAAATTCGCA. External right primer: TCAAATTGCACAAATTCCGA. Internal left primer: TGAAGTGTTTGCGTACAGCG. Internal right primer: TTTTTGGGTTTTAGGTTTTCCA. Internal WT amplicon: 1221 bp. Deletion size: 520 bp. Deletion left flank: TGCGCACGACTTGACGCGCAAACTTCCCAA. Deletion right flank: GGAAAAGCGCTCTCGGACATTGAAAAATAC. Insertion Sequence: CAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2424 C. elegans B0336.11(gk1130) T03F6.4(gk3213) III. Show Description
This strain is homozygous for a deletion (gk1130) in B0336.11, detectable by PCR using the following primers. External left primer: TGTTTCCTGAAGTGGCACAG. External right primer: AGCACTCACTGAAGGGGAGA. Internal left primer: ATTCTGCCTTGTTGCTTGCT. Internal right primer: CCGTTGCTCTCTGTGCTCTA. Internal WT amplicon: 2566 bp. Deletion size: 416 bp. Deletion left flank: TAATAAACTTCATTGCGTCAAAGCTCTGAA. Deletion right flank: CATAATTGCATATGCAATATCTACATCGTA. Validation: gk1130 passed by CGH. Other deletion (gk3213) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2437 C. elegans uaf-1(gk1036)/sC1 [dpy-1(s2170) let(gk597)] III. Show Description
Y92C3B.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1- and lethal-marked recombination suppressor. Heterozygotes are WT, and segregate WT, occasional Dpy (non-let recombinant sC1 homozygotes), and gk1036 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGAAAGATGGATTTTTCGCA. External right primer: AAAATTCGTGAAAATTGCCG. Internal left primer: ATTTCTCGCTTCCACGACTG. Internal right primer: TCACAGGAGCACATTTGACC. Internal WT amplicon: 1125 bp. Deletion size: 606 bp. Deletion left flank: ATAGATTTTTGGCAAAGAAAATGAAAATTT. Deletion right flank: GGCGTTCAATATCTTCAAGTTTCATGCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2441 C. elegans F26A1.4(gk1167) III. Show Description
F26A1.4. External left primer: TTTAGGTCTGGCACTACCCG. External right primer: AAAACATTGACACACCTGCG. Internal left primer: AAAGCGGCAGCAGTTAAGAA. Internal right primer: CTACCGGTACTGCCATTCGT. Internal WT amplicon: 1327 bp. Deletion size: 174 bp. Deletion left flank: TTATGTTTATGTTTCAGTTCTGACACGCCA. Deletion right flank: TTAAAATATTTCAGATTGAATGTGGAGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2446 C. elegans +/mT1 II; cdk-1(ok1881)/mT1 [dpy-10(e128)] III. Show Description
T05G5.3. Homozygous sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1881 homozygotes (sterile Unc). Pick WT and check for correct segregation of progeny to maintain. External left primer: CACTAAGCAATGGTCTCGCA. External right primer: CGACAACAATGGAAACATCG. Internal left primer: CGCTTACGCCTTTTCTATCG. Internal right primer: ACCATTCTCTCGTGAATCCG. Internal WT amplicon: 2136 bp. Deletion size: 1140 bp. Deletion left flank: AATCGGCGAAGGAACATACGGAGTCGTCTA. Deletion right flank: TCGTCTTCCGTGTATTGTTTAACTATCACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2449 C. elegans klp-20(ok2914) III. Show Description
Y50D7A.6. External left primer: ATCACAACGGGAATCTGGAG. External right primer: TTCAACGGCAAAAATGTTCA. Internal left primer: GAATTTGGAATCCTCCCGAT. Internal right primer: TCATATTTCTCACCTCAATTTCTCA. Internal WT amplicon: 1133 bp. Deletion size: 571 bp. Deletion left flank: ACTCCTTAGAGCTGATTGCTATCAAAAATT. Deletion right flank: AAAGGGAGGTGGAAATGGAGAAAAAGCGGA. Insertion Sequence: GGGAGGTGGAAATGGAGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2455 C. elegans B0336.11(gk1109) III. Show Description
B0336.11. External left primer: TGTTTCCTGAAGTGGCACAG. External right primer: AGCACTCACTGAAGGGGAGA. Internal left primer: ATTCTGCCTTGTTGCTTGCT. Internal right primer: CCGTTGCTCTCTGTGCTCTA. Internal WT amplicon: 2566 bp. Deletion size: 425 bp. Deletion left flank: TTCTGCTTTTCGGTCCGCGACTTGATCTTC. Deletion right flank: AAGAGTAGAAACAGCCGGGGAGCGCTGGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2461 C. elegans Y22D7AL.7(gk3210) III; R11E3.2(gk3211) ZK616.3(gk3212) IV; F39F10.2(gk1161) X. Show Description
This strain is homozygous for a deletion (gk1161) in F39F10.2, detectable by PCR using the following primers. External left primer: GTGCTCACCGAGATGTCTGA. External right primer: GCTGATTTCGCTCAACACAA. Internal left primer: GACCCGGTAATTGAGCAGAA. Internal right primer: TGCGAACATTCGTTGAGTTC. Internal WT amplicon: 2489 bp. Deletion size: 500 bp. Deletion left flank: TTCAATTAGGATGTCGTAAACGCAGTGGCT. Deletion right flank: GTGATATCCTAAAAATTATGTTTAAGTTAT. Validation: gk1161 passed by CGH. Other deletions (gk3210, gk3211, gk3212) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2475 C. elegans M04C7.4(gk3034) I; F26A1.4(gk1160) III. Show Description
F26A1.4, M04C7.4. The allele gk1160 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTTAGGTCTGGCACTACCCG. External right primer: AAAACATTGACACACCTGCG. Internal left primer: AAAGCGGCAGCAGTTAAGAA. Internal right primer: CTACCGGTACTGCCATTCGT. Internal WT amplicon: 1327 bp. Deletion size: 126 bp. Deletion left flank: TCACGGATCGGACTCTTTACCGTGCAATGG. Deletion right flank: TTTTTTAAATTGAAAATGCGAGCATCTAGG. The allele gk3034 was identified by CGH but not confirmed by PCR. Left flanking probe: GTACGGTAAGTTGGCCGAGTTGCATTATTCGTCTCGTTCAAGAGGATAAC. Right flanking probe: CAGGCACGCAGGCGCATCTGCACGTACCATGGCTACTTTAGCTGATGAAC. Left deleted probe: GATTTTATCAGCATACGGGCTCGTAAAAGAGAAGAGGAGACGAGGTTACG. Right deleted probe: CTGTGGCTGCTGTTCCAAATGCCAATCTGGAAATGGGAATTTCGGTAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2479 C. elegans +/mT1 II; F09F7.3(ok3162)/mT1 [dpy-10(e128)] III. Show Description
F09F7.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3162 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATACCCAACAGCAGGCACTC. External right primer: TTCGACAATTCCGTCATCAA. Internal left primer: TGTTACCTCAAAAGTCAAGGCT. Internal right primer: CGATTGGTTAGAGAACGGGA. Internal WT amplicon: 1204 bp. Deletion size: 794 bp. Deletion left flank: ACGTTTGGAGCTCGCTGGATCATTGCTTTC. Deletion right flank: TGGTGAAAGCCGTCAGAGATTTGAGAAGGT. Insertion Sequence: AT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2481 C. elegans rbg-2(ok3195) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T22C1.10. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3195 homozygotes (Dpy sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTTGCCAAGCAGGTTAAAA. External right primer: CGACACATTTTGTGCCACTC. Internal left primer: TATTTGCTCGGAGATTTCGC. Internal right primer: ATTCGAGCAGGTTCCGTAGA. Internal WT amplicon: 1279 bp. Deletion size: 809 bp. Deletion left flank: TTTTCAGCAAAGTTCGAACGAAAAAACTCT. Deletion right flank: TTGATAGCAAAATGCGAAAAAACAGTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2482 C. elegans F57B9.8(gk1157) III. Show Description
F57B9.8. Identified by PCR, validated by CGH. External left primer: GACAATGGACCCGAACTAGG. External right primer: TGGGACCATAAAACTTCGGA. Internal left primer: GTAATCATCGCGTCCAACCT. Internal right primer: ACGGACTTCTTCCACGAGAA. Internal WT amplicon: 1145 bp. Deletion size: 397 bp. Deletion left flank: CGAGAAAGCAAACACATCAGTTTGTGGAGT. Deletion right flank: CGAATCCGCGCATCAGACGTGCTTCTGTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2493 C. elegans +/mT1 II; ccdc-55(ok2851)/mT1 [dpy-10(e128)] III. Show Description
C16C10.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2851 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCTTTTGCTGCGTCCAAAC. External right primer: ATGCCCGTATTGCAAAGAAC. Internal left primer: TTTTTGTCAATTTTTCGGGA. Internal right primer: CAGAGAATGTTTAAAAATCCGTTAG. Internal WT amplicon: 3016 bp. Deletion size: 1577 bp. Deletion left flank: CTCCCTGATTCTCTCGATTCTATGGACTTC. Deletion right flank: AAGAATAAATAAAGTCGTAATTTTTTTTTC. Insertion Sequence: TCTCGATTCTATGGACTAAAATTAAACAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2495 C. elegans sur-6(ok3215) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26E4.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3215 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCAGCCGATGTGATCTCTTG. External right primer: TGTTCAAATCCCACACCTGA. Internal left primer: GAATATTTGGCAACGGGAGA. Internal right primer: CCTTGACAGTAAGATAGTCCCTCG. Internal WT amplicon: 1263 bp. Deletion size: 438 bp. Deletion left flank: AATCAAGTATAACATTAATGATTAAATATT. Deletion right flank: GTTAACCTTTGGAATCTGGAGATTACCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2498 C. elegans B0336.11(gk1147) III. Show Description
B0336.11. Identified by PCR, validated by CGH. External left primer: TGTTTCCTGAAGTGGCACAG. External right primer: AGCACTCACTGAAGGGGAGA. Internal left primer: ATTCTGCCTTGTTGCTTGCT. Internal right primer: CCGTTGCTCTCTGTGCTCTA. Internal WT amplicon: 2566 bp. Deletion size: 379 bp. Deletion left flank: CTTAAACAAAAACACCTACTTTCCATGAAG. Deletion right flank: ATACATCAGTTGGTTATCTAGTAATGGCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2504 C. elegans flp-15(gk1186) III. Show Description
ZK525.1. External left primer: GGCATAGCAGCAGACTAC. External right primer: CCTGAGTGTTGTGATTCC. Internal left primer: TCACACAAACCCGTTACC. Internal right primer: GGTTGCCAAGACCCGAAG. Internal WT amplicon: 2040 bp. Deletion size: 708 bp. Deletion left flank: TTGCCGAAATTGCCGATTTTCATTCAAGGA. Deletion right flank: AAAAAGCAATCAAACCGTTTGAGATATAAA. Insertion Sequence: AAAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2511 C. elegans Y52B11A.2(ok3233) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y52B11A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3233 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGAGCCTCACTCAAAACT. External right primer: AGTGGTCCATATCTCCGTCG. Internal left primer: GAAAATGTTCACGAAACGCA. Internal right primer: GGAGCAGAAAGAGGTGCTTC. Internal WT amplicon: 1301 bp. Deletion size: 675 bp. Deletion left flank: ACTAATAGAAAATTCAAAAATTGGGTGAGA. Deletion right flank: AAGATCCTAAAACTATTTTAAACTTCTTTT. Insertion Sequence: TAGATCCTAAAACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2512 C. elegans ugt-60(ok3248) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C07A9.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3248 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGGTTTCGGACTTGTTGC. External right primer: CGCATCCACTTTCTTCAGGT. Internal left primer: CTGAGAGCATCGCGGATAGT. Internal right primer: TGACGCGTCTAGCTCAATTTT. Internal WT amplicon: 1354 bp. Deletion size: 525 bp. Deletion left flank: TATAGCCTCCATGTGCAATCATTAATTTCA. Deletion right flank: AACCTCGATAGAACAAATTCTCGTCAACGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807