More Fields
Strain Species Genotype
VC1999 C. elegans eif-3.E(ok2607) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0511.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2607 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATCTCCGTGTTTGCCACA. External right primer: GATGAGAAATCCCTGACCGA. Internal left primer: TCGCCTTGACTTTGTCTTGA. Internal right primer: GACTCCGTTGTTGCCATTTT. Internal WT amplicon: 1140 bp. Deletion size: 578 bp. Deletion left flank: GTTCAGCTTCCTCTTGGCTCATATTCAATC. Deletion right flank: CCATTCTTGGAGCAGAATTTCACTGGCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC20 C. elegans nhl-1(gk15) III. Show Description
F54G8.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2005 C. elegans ZK973.9&lpd-5(ok2652) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK973.10, ZK973.9. Homozygous lethal/sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2652 homozygotes (late larval arrest or sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTTGAGGCTGTTGTTGGTT. External right primer: GAATCGGCGCTACTCATCTC. Internal left primer: GCAGCGGTACCATCATCTTT. Internal right primer: TTACAACGGGAGACAAAGGG. Internal WT amplicon: 2218 bp. Deletion size: 1384 bp. Deletion left flank: ACTCCTTTTTTGCAAAAAAAAACAAACAAA. Deletion right flank: TGCTTGTACGAGAACACATACCATTCCCTT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2018 C. elegans F16D3.4(ok2634) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F16D3.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2634 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCGGGAGATTCAAATAAGG. External right primer: TTTTGCAGCAATGGATGAAG. Internal left primer: CAAAACGCGTCTCCATTTTT. Internal right primer: ATGCACCAGTCGATGAGTCG. Internal WT amplicon: 1161 bp. Deletion size: 464 bp. Deletion left flank: CCGTCAAAACTCTCCGATCAACGTGTTTGA. Deletion right flank: CGTACAATACACAAATCAGAAAGATATTTC. Insertion Sequence: CAAATACACAAATCAGAAAGATATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2019 C. elegans B0336.3(gk910) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0336.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk910 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTACCCCATTGGTTCCTCCT. External right primer: TCAATTCCATCTCGAGGTCC. Internal left primer: ATTCTCGCATTTCTTTGCGT. Internal right primer: ATTTGGGCTGCAATCTCATC. Internal WT amplicon: 2166 bp. Deletion size: 408 bp. Deletion left flank: ATGGTTCCACTCCCGGCTACCGCTCCTAAT. Deletion right flank: CTTCAAGTTGCCAAGATTCCACCAGAGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2031 C. elegans R07E5.1(ok2653) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R07E5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2653 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTTTTTGGGCCATTTTGAG. External right primer: CCATTTTCACAGCGGCTAAT. Internal left primer: AATTAATTTTTCCAGGCGGC. Internal right primer: CACAAATTTCGAAGCCATCA. Internal WT amplicon: 1186 bp. Deletion size: 399 bp. Deletion left flank: ATTTGCTAAAGTTTGAGTTTACGGGTTTTT. Deletion right flank: CTGTCTGGGAGTGGGAGTGGGAAAAGAAAG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2037 C. elegans C46F11.3(gk1070) III. Show Description
C46F11.3. External left primer: AGCAAAAGAATTGGCGAAGA. External right primer: CGATACCTCCAGATCCTCCA. Internal left primer: TATCACCAGGTGTGCATTGG. Internal right primer: AACTCCTTGACGCCAGACAT. Internal WT amplicon: 1888 bp. Deletion size: 971 bp. Deletion left flank: AAATCAGGCGTTGATCCCATAGGACTAAAA. Deletion right flank: TTTTAAACTCTTCGCGCGCTGAAAAAGGGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2049 C. elegans Y48A6C.1(gk955) III. Show Description
Y48A6C.1. External left primer: GGGTTTTCAGCCATTTTTCA. External right primer: AATTTCAATCAGAAACGCGG. Internal left primer: TTGTATCGATTAATCCCGGC. Internal right primer: TTTCGTCCGAACCGTTAGTC. Internal WT amplicon: 2443 bp. Deletion size: 1549 bp. Deletion left flank: CCATTTTTCAGCAAAAATGCACTGACTCTG. Deletion right flank: CGTAAATTTTTTCGGGTTTTTAAACTCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2053 C. elegans wip-1(ok2435) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R144.4. Homozygous sterile or near-sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2435 homozygotes (grotty, Unc, with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGTATTCCGAAGTGCGAC. External right primer: CCATGAAGAAACCCAGGAAA. Internal left primer: TCAGAAAGATTGTTCCGGTTTT. Internal right primer: GGGGGATTGACGGACTATTT. Internal WT amplicon: 3053 bp. Deletion size: 1544 bp. Deletion left flank: AAATAAGACGGTAAAGAATTTTATCAGAAT. Deletion right flank: TCAGTTCCAAGCTCAAAACCGACTCCACCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2099 C. elegans mat-3(ok2476)/sC1 [dpy-1(s2170)] III. Show Description
F10C5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2476 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACTTTCGCCGTTTGATGTC. External right primer: CCGAAAATTAGCCGATTTGA. Internal left primer: TGATAAATGGTGTGCTCCGA. Internal right primer: GATTTATCCGTCAGCCGAAA. Internal WT amplicon: 2623 bp. Deletion size: 1324 bp. Deletion left flank: CTAAGGCCATAAAAATCAACAAAATCTAAA. Deletion right flank: TATTTAGCAGACCAAAGTTGGGTATCCAAT. Insertion Sequence: GAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2100 C. elegans Y56A3A.2(ok2738) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y56A3A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2738 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTAAGCTCCGCCCATTTCT. External right primer: AACATCAATTTTGCCGGAAG. Internal left primer: GCTATTTCGCACTAAAATTGTTCA. Internal right primer: GAAGTTTCAATTCCGGCAAA. Internal WT amplicon: 1156 bp. Deletion size: 411 bp. Deletion left flank: ACGTTCGAATACACCTCCACCAGTCGGCAA. Deletion right flank: GTGCCAGAATTTGAATTTCCGGCAAATCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2105 C. elegans arx-5(ok1990) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y37D8A.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1990 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGGATTTTTCTGCGTCTC. External right primer: GGCCAATATGCTTTTCGTGT. Internal left primer: GATACCGTGGCGTTTTTGTT. Internal right primer: CGGGTCTCAACACGAAAAAT. Internal WT amplicon: 2347 bp. Deletion size: 879 bp. Deletion left flank: ATAGAGATTTCGCGTATTTCGCGCACAACA. Deletion right flank: AAAAATCTGTTTTCGGTAGGAATGTTCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2111 C. elegans rha-2(ok2639) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C06E1.10. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2639 homozygotes (grotty sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGCCAATGTTTTTCCGAGT. External right primer: TTCCACTTCGTTCCAAAACC. Internal left primer: CGTGATTCTTGCTTCCGTTT. Internal right primer: GTTATCAAAGTTGACGCCCG. Internal WT amplicon: 1103 bp. Deletion size: 558 bp. Deletion left flank: TCTGGAAATTAGCTTTTTTATTCTATAAAT. Deletion right flank: AGAATGGCACCCGGTGGTAGAGTTTCATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2112 C. elegans Y71F9AL.17(ok2824) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y71F9AL.17. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2824 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTTTGACTTTTGCCCCCTT. External right primer: TCAGCAAGGATGTTGCTCTG. Internal left primer: AGCTGTCTGGAAATGTCCGT. Internal right primer: CTCCGTTACCCACAACCATT. Internal WT amplicon: 1146 bp. Deletion size: 766 bp. Deletion left flank: TGACAAGCTTATCCGTATTTCCAGTAACAA. Deletion right flank: AGCCGTGTTGATATTCTCGAGTTTGCGAAG. Insertion Sequence: GATACAAAAACGAGAGCTTCTCAAAGTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2118 C. elegans asd-1(ok2299) III. Show Description
R74.5. External left primer: TGGATTGTGAAAACCCCCTA. External right primer: GATGCAGAGCCTGTGAGTGA. Internal left primer: TGCGCCCCCATAATAAATAA. Internal right primer: GCAGCGACTTGATTTTGTGA. Internal WT amplicon: 3250 bp. Deletion size: 1611 bp. Deletion left flank: TCTTTCAATCTTTCATTTCTAACCGATTTC. Deletion right flank: TCAGGTAAGGAAAATAGTGTTTCGTGATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2119 C. elegans K07A1.13(ok2573) III. Show Description
K07A1.13. External left primer: TTACGCGATGCGATTCAATA. External right primer: GACGACGGGCATCTGTAAAT. Internal left primer: CCAATTATTCCAATAAATACGAAAC. Internal right primer: GTGGTTTCATTCTCGTATCTCAG. Internal WT amplicon: 1198 bp. Deletion size: 516 bp. Deletion left flank: TCTCGTATCTTGCCATGTAGATGTAATGCA. Deletion right flank: AAAGTTTTGAGTTATTTCATATCGAGCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2120 C. elegans W03G9.5(ok2325) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
W03G9.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2325 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTCTGCACATTTTTCTCG. External right primer: CCGTGAAATTCCCAGTGAAC. Internal left primer: GAAACTTGGAAAACCGCAAA. Internal right primer: GGATTTGCCGAAGATTCAAA. Internal WT amplicon: 2805 bp. Deletion size: 790 bp. Deletion left flank: ATTATTAATATTGAGCTCCCCCATGCCTGC. Deletion right flank: TTCCATTATTCCCGTCCTGAAAAAAAATGA. Insertion Sequence: TCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2127 C. elegans mog-4(ok2708)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
C04H5.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2708 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCTTCGCCTGCAAATCAC. External right primer: TTCATGCCGTACCTGTTCAA. Internal left primer: TCTTCGATCCCAGTGCTTTC. Internal right primer: AAGGAGCAAAACTTCGATGG. Internal WT amplicon: 3202 bp. Deletion size: 2453 bp. Deletion left flank: ATACCAAAATATCGCCGGGAAGTGGCTGGG. Deletion right flank: GCGAATAAAAGTCGAAAAAAAAATGTTTTG. Insertion Sequence: ATTTTTTTTCGTTTTTTTTTGGGTTTATTCGAAGTATTGATTAAAATTTAAGAGCGATC GATTTTTTTCTTAATTAAAAACAAAAATCCTGAATGTTTGGTTTTTTTGCTGTTTTTGT AAATGTTCTAAAAATTACCTATAACTAGCCAAATCGGGTTCGTTGAGAAACTCTCTGAG CAGCATTCCGTCTGTCATGTATTTGAGGACAGTCTTCTCCGATGTGCAATCCTCGAAAC GAATACTGTAGCCGACCTGGAAAATGGAAGCGTTTCGAAAGAAAAATCGGAATCTGTTT TCCTCGTTTTTTTACAAGTTTAAAAATTTTTAGAAGCGGCAAAGAATTGCCCAAATTTT TTTAACTTCCAGTTTTTTTTTCTAAATTTTGGAATTTTCCGACTAGAATGAAACTTAGT TTATTTTCGCCAATTTCCAAAAACCACCCAACCTGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2135 C. elegans lelo-2(ok2740)/sC1 [dpy-1(s2170)] III. Show Description
Y82E9BR.16. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2740 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACCTGGGGATTTTAGCG. External right primer: TATCACCACATTTCCCGTCA. Internal left primer: AATTTGAAAATTTTTGAGGTTTCAT. Internal right primer: TTTCGCGGAAATATTGAACTTT. Internal WT amplicon: 3097 bp. Deletion size: 1978 bp. Deletion left flank: TTTTTTCAAATCGTTGCTAAATTTGAATTT. Deletion right flank: GGGCTTTTTCAGCAATTTCCGGGTAATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2136 C. elegans Y48A6C.1(gk961) III. Show Description
Y48A6C.1. External left primer: GGGTTTTCAGCCATTTTTCA. External right primer: AATTTCAATCAGAAACGCGG. Internal left primer: TTGTATCGATTAATCCCGGC. Internal right primer: TTTCGTCCGAACCGTTAGTC. Internal WT amplicon: 2443 bp. Deletion size: 1511 bp. Deletion left flank: GATGTCCTTTCTCTTTTCCTTCTCAACAAA. Deletion right flank: GGTCAAAAAAATTATTACACATTCCCGCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2139 C. elegans C09F5.1(ok2863) III. Show Description
C09F5.1. External left primer: GTGGAGCAAATCGAGGTCAT. External right primer: CCACACAAGAATGTGTTGGC. Internal left primer: GCATCGAATAATTGAAGAGGG. Internal right primer: CCACGTCTTCTCTAGTGGGC. Internal WT amplicon: 1262 bp. Deletion size: 403 bp. Deletion left flank: TTTACTTTTCGGCACGTGGCGTCAGAGTGT. Deletion right flank: ATGATATTCACGAAGTGCGCACTGATGGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2153 C. elegans T235F11.1(ok2186) III. Show Description
T23F11.1. External left primer: GAGACCCACTCGCTAACCAC. External right primer: GCGGGATGAACAATAGAGGA. Internal left primer: CTTCTGTCTCTCGGAAACGC. Internal right primer: CGAAAGGTATTTCAACCGGA. Internal WT amplicon: 3253 bp. Deletion size: 1421 bp. Deletion left flank: GAAAGTTATCAGAGCAAAAATGTGATAAAA. Deletion right flank: CTGACAAGCTGACACCGGATCACGAGTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2160 C. elegans T20G5(gk1007) III. Show Description
T20G5. External left primer: ATCAACCGGAGAACACGAAC. External right primer: AACCTGTTTGAATCGAACGC. Internal left primer: GCAAATGCACTAGATGCGAA. Internal right primer: GATTGGACGTGATGGAGGTT. Internal WT amplicon: 1084 bp. Deletion size: 306 bp. Deletion left flank: AAACCTTCATATCTTCCATTACTAATAGGT. Deletion right flank: TTCGTTCCGCTCTTTTCCGAAAGGGATTTC. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2164 C. elegans sdz-1&vps-33.1(ok2494) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0303.8, B0303.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2494 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAGCCCTGGAAGACATTGAT. External right primer: AGTGAAACCATTGTCGGAGC. Internal left primer: ACCACCATACGGATCTCCAA. Internal right primer: CGGACTTTTTGGTTTCGATT. Internal WT amplicon: 2348 bp. Deletion size: 1060 bp. Deletion left flank: GAGTTTGGTATCCAGGTGTTGAAGTTTGAA. Deletion right flank: ACTGGGAAGGGACTGTTAGTTTTCTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2166 C. elegans nuo-4(ok2483) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K04G7.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2483 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACCCAAACGTGGCAATA. External right primer: TTGTTAAGACCATCATGCCG. Internal left primer: AAAAGTGTGCGTGGGGTAAT. Internal right primer: GTTCCATGAGCAAATTGGGA. Internal WT amplicon: 3154 bp. Deletion size: 1295 bp. Deletion left flank: TCTATTACTTAAAGCAAATTTTCAAATTGA. Deletion right flank: AGTCTAGAAACAATTATTTTGAAAGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2171 C. elegans tkr-1(ok2886) III. Show Description
C38C10.1. External left primer: TGGTCATGGTCGAATCCATA. External right primer: ACATTTTCCAATTCTTGCGG. Internal left primer: CTGCAATTGAATCGGAAACA. Internal right primer: TTTTGTTGCTCCGGATTTTC. Internal WT amplicon: 1214 bp. Deletion size: 755 bp. Deletion left flank: TACTATGACTGGTGGTATGGTGATCTATGT. Deletion right flank: ACTATCAAAAAATCAATGAAAATCCGGAGC. Insertion Sequence: GGTGATCTATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC218 C. elegans dgk-3(gk110) III. Show Description
F54G8.2. Superficially wild type; at low penetrance bursts at vulva. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2183 C. elegans ncbp-1(ok2787) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F37E3.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2787 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGAAAAATATCGGGCTTCAA. External right primer: CCTTCCAATCTGTCCAGGTG. Internal left primer: GCCATCTATCTCCCAAATCG. Internal right primer: ATTAAACCCCCGCTAAATCG. Internal WT amplicon: 1121 bp. Deletion size: 534 bp. Deletion left flank: CTCAAAATCTTGCTATTTTCCTTTGTGATC. Deletion right flank: GCGGATTGTTCCGCCTTTTCTGTAAGTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2184 C. elegans +/mT1 II; rpb-2(ok2893)/mT1 [dpy-10(e128)] III. Show Description
C26E6.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2893 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGAAGCATGGCAAGAAGCAT. External right primer: GCTTTCTTTTGATCACCCCA. Internal left primer: ATGTGCAGCGAATTGTTGAG. Internal right primer: GACGCAGACATCAAGAGCAA. Internal WT amplicon: 1187 bp. Deletion size: 331 bp. Deletion left flank: GATTATGATTGTGTTCCGAGCGCTGGGATT. Deletion right flank: GGAAACAAAAGACTGGATTTAGCCGGACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2189 C. elegans K10D2.4&cid-1(ok2757) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K10D2.4, K10D2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2757 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 713 bp. Deletion left flank: AGGCTGAAACAACCTTCATTTTACTTTTGC. Deletion right flank: AATGAAGTATATTAGGCCCTTCGTATTGCT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2199 C. elegans rab-5(ok2605) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26H9.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2605 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTGCTGAAAACCGTCACAA. External right primer: GCTCATTCACTGGCTGAACA. Internal left primer: TTGCGTTGATTTCGAAGTTT. Internal right primer: TTCGAGGGGAAAACAATGAC. Internal WT amplicon: 1186 bp. Deletion size: 359 bp. Deletion left flank: GAAAGACGTAAAAACGTTAATAATTAAGAA. Deletion right flank: ATAAAAACATGTTAACAGAGTACTGAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2200 C. elegans grl-22(ok2704) III. Show Description
W03A5.3. External left primer: TGACGGTGAGGACGTATTGA. External right primer: GCCACCGGATAGTTTTTCAG. Internal left primer: GGAGAAGATCATTGCCGAGA. Internal right primer: AAGTTGCCTTGAAAGTTTCCATA. Internal WT amplicon: 1221 bp. Deletion size: 573 bp. Deletion left flank: CGAGTCCGAAGGGGTGGATTTCATGTTCTG. Deletion right flank: CATTCTGCAAATGAAGGTTCTGAAGAAAAT. Insertion Sequence: TTCTGCAAATGAAGGTTCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2202 C. elegans T05G5.8(ok2864) III. Show Description
T05G5.8. External left primer: AGAGCAGCATCACAAGTGGA. External right primer: CTGGAAAAGGGGGACAAAAT. Internal left primer: CAACATCCTGAACTAAAACCTGG. Internal right primer: TATGTGTAGAGTGGCGGCTG. Internal WT amplicon: 1123 bp. Deletion size: 373 bp. Deletion left flank: CCAGGAACTCATTTAAAGTTTTCTCTTGAG. Deletion right flank: TTGCTGTTCGATGAACCATTTTACAAAGTT. Insertion Sequence: TATTTATAAATACATCCAAGAAAGTATCAAAAACACTCCAAATAGCTTTTTCGAATGAA A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2203 C. elegans taf-9(ok2871) III. Show Description
T12D8.7. External left primer: ACGATTCTCACGGAAACGTC. External right primer: AAGGTGGCTCCAAACAACAC. Internal left primer: TTCCATTAATTTCCTCGGCA. Internal right primer: TTCTACCCCGCATTTTTCTG. Internal WT amplicon: 1258 bp. Deletion size: 427 bp. Deletion left flank: GCCCAACGATCGATTCTGTCAATTACAGCA. Deletion right flank: ATTTTCCGACACTACTTGAATAACCCCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2209 C. elegans lgc-46(ok2949) III. Show Description
Y71D11A.5. External left primer: CCAGTTTCAGCTGTGTCGAA. External right primer: GTTTTGCACGTACTTCCACG. Internal left primer: AAACTAGGCTTGTTGGGGGT. Internal right primer: CGAAGCTAATAATGGTGCCAA. Internal WT amplicon: 1314 bp. Deletion size: 492 bp. Deletion left flank: TCCCGGGAGAGGTAGCCGACCCAGGCGAGT. Deletion right flank: AACTCCCACGAATTTCTAGATAAACTCACT. Insertion Sequence: CCCACGAATTTCTAGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2216 C. elegans K10D2.4(ok2759) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K10D2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2759 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 658 bp. Deletion left flank: TTAAAATCTCAGCGGGAGTTTGATCAAATT. Deletion right flank: CATTGGGAAAGACGAACCGAATAATAGGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2218 C. elegans H19M22.3(ok2827)/sC1 [dpy-1(s2170)] III. Show Description
H19M22.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2827 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCCGTGACGCTTAAATGG. External right primer: ATAATTCAGTGCCCGAGAGC. Internal left primer: ATCTCCGACTACACCAGCGA. Internal right primer: AGCGTCCGTTGACTTGAGTT. Internal WT amplicon: 1135 bp. Deletion size: 538 bp. Deletion left flank: AGAAAAAAATCTAGCAGATTGCAAAATCTA. Deletion right flank: AGTGTGCAGTGAGCAGCTGCTGCGACAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2223 C. elegans ZC434.7&ZC434.8(ok2797) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZC434.8, ZC434.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2797 homozygotes (grotty sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCATCACATCGACACTTCC. External right primer: AAGGAGCTTCTGACTGCTCG. Internal left primer: GAATCGAGACGAGACGGAAT. Internal right primer: AGAAGCACTTGACAAAGGACG. Internal WT amplicon: 1371 bp. Deletion size: 991 bp. Deletion left flank: AGAAACATTAAACGTTATAAAGTTGAAGTT. Deletion right flank: AAAAAGTAATTACATTTTTCTCTCCCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2224 C. elegans F46F11.11&ubl-5(ok2820) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F46F11.4, F46F11.11. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2820 homozygotes (viable but sickly). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAATCGGGACAGCTTCAGA. External right primer: CGCAAGTGTGAAACGCTATG. Internal left primer: AGCCATGATTTACAGGGTTCA. Internal right primer: TGCAGATTTTACCATACTTGCG. Internal WT amplicon: 3053 bp. Deletion size: 2291 bp. Deletion left flank: GTTACTGTACTTCTTTAAGGCGCACGCAAT. Deletion right flank: TCGACGCGCAAATGCAGACTTGCAATGTAA. Insertion Sequence: ACAATTGGAGATTTGAAATGTACGTAAAAACACACAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2225 C. elegans npp-6(ok2821) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F56A3.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2821 homozygotes (sterile with spiky vulva, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGGCCAATATTCGAGTTTC. External right primer: CGTGTCAGTAGCGTCATCGT. Internal left primer: CATTGCTCAACGCAATCACT. Internal right primer: GCTCGATCGTCTGAAAAACA. Internal WT amplicon: 1360 bp. Deletion size: 549 bp. Deletion left flank: ATGATGAAGAAAGAGGGTGGTTACGGACCA. Deletion right flank: CAATCACTCAAGCTTATTCTCAGGACAACA. Insertion Sequence: TATGGCTATGATGAAATTCGAGAGTGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2229 C. elegans pfd-6(ok2785) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F21C3.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2785 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: ATTTCAACGCTGCTGGAGAC. Internal left primer: ATGATGGCTGACTTTGAGCA. Internal right primer: TGCAAAGTTGGTTTTCACGA. Internal WT amplicon: 1193 bp. Deletion size: 286 bp. Deletion left flank: GATGTAATTAGCAATGACTTTTAACATAGA. Deletion right flank: TGTCTGAGATGCTGGCTTCCACTCGTTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2232 C. elegans his-70(ok2906) III. Show Description
E03A3.4. External left primer: TCCGTAAACTTTAGGCCACG. External right primer: TGTTCATTGAAATCACCGGA. Internal left primer: CCATCCACTGCAGACACAGT. Internal right primer: ACGTTTTTGAACGAAATGGG. Internal WT amplicon: 1317 bp. Deletion size: 370 bp. Deletion left flank: AAGAAACACGGGCATTGATCAAGATTTTAT. Deletion right flank: CGGGGAAAACCTTACGAGCAGCCTTCGTCG. Insertion Sequence: GATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2235 C. elegans Y53G8AR.9(gk995) III. Show Description
Y53G8AR.9. External left primer: GCATTTCGCTTCTCCAACTC. External right primer: TCCGATTTTGAGCAATTTCC. Internal left primer: TCGTTCCAAATCCACATTCA. Internal right primer: TTTCCCTCCGATTTCTCTCA. Internal WT amplicon: 2634 bp. Deletion size: 1774 bp. Deletion left flank: GATTCTATAAAAATTGAGGCGAATTAGAGA. Deletion right flank: TCTACAAAAAATTGGGAATTTTTGGGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2236 C. elegans pbs-4(ok2856) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T20F5.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2856 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGCAAAAAGCTGCGATATG. External right primer: GCAAACAGCTGCTGAAACAA. Internal left primer: ATGCACTTGGCACCTTGATT. Internal right primer: CGGAAGAAAACTGGGAGAAA. Internal WT amplicon: 1272 bp. Deletion size: 675 bp. Deletion left flank: GTCAAATAGTGCGCATTGGGCGCGCACACC. Deletion right flank: ATTATGGATCGTGAATACAAAAAAGGTAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2238 C. elegans B0205.6(ok2890) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0205.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2890 homozygotes (sterile unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGAACAAAACCAGCAAT. External right primer: CCTGTCCTCCACCAGACATT. Internal left primer: CTCGAGTAGTCGACGCAATG. Internal right primer: GCTTCAATACGAACACGTGGA. Internal WT amplicon: 1094 bp. Deletion size: 255 bp. Deletion left flank: ACTGAATCAAATAATTTGGCGATTAAAGGA. Deletion right flank: ATATTTGGAAAATGAAGGATTTAAAGTGAC. Insertion Sequence: TTTTGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2240 C. elegans acs-4(ok2872) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F37C12.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2872 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTTTCAGGCAAATTGGGT. External right primer: TTCCTGTGCTCAAGTCGTTG. Internal left primer: ATGTTTGGGAACTCGACAGC. Internal right primer: ATCCTTGAACAACAGGGCAG. Internal WT amplicon: 1170 bp. Deletion size: 335 bp. Deletion left flank: CTGAAGACCCTGATTTATTTCGCTCCTGTG. Deletion right flank: AATTTTTATTGGATTTAAAACTCATTTTAC. Insertion Sequence: CGAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2242 C. elegans C10G11.9(ok2839) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C10G11.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2839 homozygotes (grotty sterile or maternal-effect sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAATCGGTGGCTAGGTGAAA. External right primer: CTGGAAGGAGCACCCATAAA. Internal left primer: CATACACGACTGATATGCTTTCAA. Internal right primer: TGACCCTCTCAAGAAGAACGA. Internal WT amplicon: 1315 bp. Deletion size: 672 bp. Deletion left flank: CTGCTGGCTTCTGCTGCGGCTACGTCTTTT. Deletion right flank: TAAGCTTTTATAGTGAGCATTGATGACCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2243 C. elegans tufm-2(ok2850) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C43E11.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2850 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGCTATGAAAGTCCTCTGC. External right primer: CGACTCTCCCCGACATTTTA. Internal left primer: TATTCCCACACTGATTGCCC. Internal right primer: TGAGCAGATCAGGTAAAACTGC. Internal WT amplicon: 1303 bp. Deletion size: 499 bp. Deletion left flank: CGGATTTCATCAAAAATATGATTTGCGGAA. Deletion right flank: TGTTTTTCAGGAACAGTCATCGTCGGTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2245 C. elegans ZK1236.1(ok3023) III. Show Description
ZK1236.1. External left primer: TAATTGACCGTGTTCCAGCA. External right primer: TTGAGTCGTTCCATTCCTCC. Internal left primer: TATTTCGATCATTTTCGCGG. Internal right primer: CCACCAAAGTTTCCCTTCAA. Internal WT amplicon: 1179 bp. Deletion size: 508 bp. Deletion left flank: GGTTGGAGAGACACTTTTCGCTGAAACAAC. Deletion right flank: GATTCGACTCGTCTCGTGATCCTTTGGAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2254 C. elegans ZC395.10(ok2968) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZC395.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2968 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTGCCCATGGAAACTGATT. External right primer: CAATGCCATTCGCACTTAAA. Internal left primer: GAAAAACGAATGCGGGATAA. Internal right primer: TCTTGCTTGTTATTGCCGTG. Internal WT amplicon: 1196 bp. Deletion size: 501 bp. Deletion left flank: ATCCGTTCGCCATTCCACCGCCAATTCCGG. Deletion right flank: TAATTCGAAAAGAGAACTAGACGGATACGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807