B0336.11. Identified by PCR, validated by CGH. External left primer: TGTTTCCTGAAGTGGCACAG. External right primer: AGCACTCACTGAAGGGGAGA. Internal left primer: ATTCTGCCTTGTTGCTTGCT. Internal right primer: CCGTTGCTCTCTGTGCTCTA. Internal WT amplicon: 2566 bp. Deletion size: 379 bp. Deletion left flank: CTTAAACAAAAACACCTACTTTCCATGAAG. Deletion right flank: ATACATCAGTTGGTTATCTAGTAATGGCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK525.1. External left primer: GGCATAGCAGCAGACTAC. External right primer: CCTGAGTGTTGTGATTCC. Internal left primer: TCACACAAACCCGTTACC. Internal right primer: GGTTGCCAAGACCCGAAG. Internal WT amplicon: 2040 bp. Deletion size: 708 bp. Deletion left flank: TTGCCGAAATTGCCGATTTTCATTCAAGGA. Deletion right flank: AAAAAGCAATCAAACCGTTTGAGATATAAA. Insertion Sequence: AAAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y52B11A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3233 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGAGCCTCACTCAAAACT. External right primer: AGTGGTCCATATCTCCGTCG. Internal left primer: GAAAATGTTCACGAAACGCA. Internal right primer: GGAGCAGAAAGAGGTGCTTC. Internal WT amplicon: 1301 bp. Deletion size: 675 bp. Deletion left flank: ACTAATAGAAAATTCAAAAATTGGGTGAGA. Deletion right flank: AAGATCCTAAAACTATTTTAAACTTCTTTT. Insertion Sequence: TAGATCCTAAAACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07A9.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3248 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGGTTTCGGACTTGTTGC. External right primer: CGCATCCACTTTCTTCAGGT. Internal left primer: CTGAGAGCATCGCGGATAGT. Internal right primer: TGACGCGTCTAGCTCAATTTT. Internal WT amplicon: 1354 bp. Deletion size: 525 bp. Deletion left flank: TATAGCCTCCATGTGCAATCATTAATTTCA. Deletion right flank: AACCTCGATAGAACAAATTCTCGTCAACGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T03F6.5. Homozygous sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2796 homozygotes (sterile, lays eggs that don't hatch). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTGGGGCACTGAGATTTT. External right primer: CATGAACGTAATTCGGCAAA. Internal left primer: AAGTGCTCATGCGCTTCAAT. Internal right primer: CGATTTCCCAGAAAAATGGA. Internal WT amplicon: 1174 bp. Deletion size: 718 bp. Deletion left flank: CTCTTTTTTTTTAATTAAACATTTTCATAT. Deletion right flank: AGCCCATTCGACGCATTCCACAGCATGCTC. Insertion Sequence: ATATGAAAATATGAAAATGTTTAATTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y32H12A.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3136 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGAGAACGCGAAAACAAGA. External right primer: CAGGACATCGTCCTCCACTT. Internal left primer: GGAACGAAAAGGGGGAATAA. Internal right primer: CGTTCAGTAGCTGCTTCAAGA. Internal WT amplicon: 1358 bp. Deletion size: 299 bp. Deletion left flank: AAAAGCGGCGAGCACGACAAATGTGTGAAA. Deletion right flank: TATACATGGCTCCCATCATAATCATCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y43F4B.4. External left primer: CAGCACATTGCCCTACTGAA. External right primer: TTTTCAATGGAAAGGCAAGC. Internal left primer: GAAAACGTACCCCCTCGATT. Internal right primer: TATTCGGCTCCGAGGAGAG. Internal WT amplicon: 1259 bp. Deletion size: 338 bp. Deletion left flank: TGGATGAAAAGTCTTTAAAATGTATCAATT. Deletion right flank: GAAGATTTTTATTTCCAGGTTTCATTCGAT. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W09D6.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38E4B.10. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2517 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTTTTGGCCTAAAAATCGCA. External right primer: ACCACATCCAATGCACAAGA. Internal left primer: CGCGGAGCAACTGATTTTAT. Internal right primer: TTCACTGGGCAAGCTCTTTT. Internal WT amplicon: 2301 bp. Deletion size: 1379 bp. Deletion left flank: TTTTAACATTAAAAATGATCTATATTTACC. Deletion right flank: GTTTTCCATCCAATTTCATTGATTTTTGAG. Insertion Sequence: TATATATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39E4A.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2650 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGGTGGAGCGTAATTTTTCA. External right primer: CGACATTTTGCGGACTTTTT. Internal left primer: GGCACGGTTTTCCTCTTTTT. Internal right primer: GTGGCTGGTGATTTTTCCAC. Internal WT amplicon: 1226 bp. Deletion size: 520 bp. Deletion left flank: TTTCTCCAGAAATATCGATTTTTTAAAAGC. Deletion right flank: CGGAAAGCGTCTCCTTCAACGGTAGAAGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K04C2.6. External left primer: ATTCCCAAATTCGAAGAGCA. External right primer: CCATCACAACACCACCACAT. Internal left primer: AAATCTCATTATGACAACGAACAAA. Internal right primer: GCATCCAATCCATGCAATTA. Internal WT amplicon: 1203 bp. Deletion size: 580 bp. Deletion left flank: GTGTGGTCTACAGTAAAAGAGCCCAAAGAA. Deletion right flank: GTATCATTGTAAATTGTATAACTCAATTGT. Insertion Sequence: AAGAGCTACAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F07A5.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3267 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAAAACCAACCGGTTCAAG. External right primer: ATCACCAAACCGTTCAAAGC. Internal left primer: CTTGAAAAGAGCACCGATGA. Internal right primer: GGTGCTAAACAACATTTCGGA. Internal WT amplicon: 1264 bp. Deletion size: 544 bp. Deletion left flank: ATTAAAAGAATTCCGTCGGCACACAGGTAC. Deletion right flank: CACGAATCAACGTCCAAGAATTTGCAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09F7.7. External left primer: GGTGTCCATCCCAATCAATC. External right primer: CGATCACATTCGTCAAATCG. Internal left primer: CGAGCCGTTCACTCCTTATC. Internal right primer: CAATTCCAACGACAAATCTGAA. Internal WT amplicon: 1340 bp. Deletion size: 939 bp. Deletion left flank: GACAAAACAGACAGAAAAAAGGAATTATCA. Deletion right flank: TTCAGATTCTGACAGAAAATTGTGAATGAG. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45G2.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1721 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGATTACCAGCGGACTGT. External right primer: AGAGGCAAAAGCAATGATGG. Internal left primer: TCCGATCAAGCTGAACTGTG. Internal right primer: CGCCTTTTCTCCCCTACTTC. Internal WT amplicon: 2848 bp. Deletion size: 954 bp. Deletion left flank: AAAACGGGGGTGAAGCCATTTACTTTCAGG. Deletion right flank: ATTTGGTTATAAGATGATGGCTTGTGCATG. Insertion Sequence: TCTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y75B8A.24. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3320 homozygotes (grotty sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTTCCCCTACCTAACAGCC. External right primer: GAGAAGGAAGTTGTCGGTGG. Internal left primer: ACAGAAGCTCATCTGCCGAG. Internal right primer: ACGTCGCATCCTACTCGTCT. Internal WT amplicon: 1206 bp. Deletion size: 389 bp. Deletion left flank: CTCATCTGCCGAGTAACTTCTCAGCACTCT. Deletion right flank: CCAACGCTAGCGGATGGAGCCAAGCACTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23C8.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3325 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGGGGTCAAAGTACACACT. External right primer: CCGCAGATACACACACATGA. Internal left primer: CCGAAATTCGAAATTTTAGCC. Internal right primer: TTTTTATCGCTTTCTTGCGAA. Internal WT amplicon: 1309 bp. Deletion size: 702 bp. Deletion left flank: GTCGGCAGAGCAGTTGGCACGTTTGACGGA. Deletion right flank: GTGCTTTTATAAGTTAAATTTCGCAAGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C44F1.2. External left primer: CAGGCTTGCATCGAATATGA. External right primer: GAACTGGAAGCTTCTGGGAA. Internal left primer: GCGACAGAAAGACTGGAAGG. Internal right primer: TGGTACGAACAGTACAGAACAAAAA. Internal WT amplicon: 1119 bp. Deletion size: 559 bp. Deletion left flank: CAACGGGCAGAGCTCCAGTTAACAAACGTC. Deletion right flank: CAGAAGCCGATTGTGAATCGAGTGCAATCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09G8.9. External left primer: ACTCGCCACGAAAAACATTC. External right primer: CCACCAAAACCACAGAAACC. Internal left primer: CAATTGCCACTCTCCTTTCC. Internal right primer: CAGTTCAGCCAACAATCGTG. Internal WT amplicon: 1085 bp. Deletion size: 668 bp. Deletion left flank: ACTCCTCTGAAAATTGAACCTCTTTTTGTT. Deletion right flank: TCTTCAATTAGGTATTTATAATTGAACGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y75B8A.11. External left primer: AATGCCCAGCATTCTTCAAA. External right primer: TTGCCAGAGGAAAGCTCACT. Internal left primer: GCATGCACCTCAAAGAAAAA. Internal right primer: CGATGCTATTCGTGACCTGA. Internal WT amplicon: 1334 bp. Deletion size: 682 bp. Deletion left flank: CCACCAGCACCATAAACCATCAAAAGCTTG. Deletion right flank: GGCTGGGACTTTTTTGGTTTTTTTTTGTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48A6B.8. External left primer: CGGAGACATCATGCTCATTG. External right primer: GGGACAGCACAGACAGATCA. Internal left primer: GACCGGTTGCACTGTAATGA. Internal right primer: AAATGGGCAACGTTGTGAAG. Internal WT amplicon: 1237 bp. Deletion size: 817 bp. Deletion left flank: GATTAAAAGTATTGAGTTACTTACAATCTG. Deletion right flank: CTTTGAAATTTTCGATGTCAGGGTGTGCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54E2A.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3305 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATTCGCTCAAAATCCATGC. External right primer: AAAATAAATGATGACGCGGG. Internal left primer: ATCAAAACAAATTCGGCCTG. Internal right primer: TTTTCACGAAAAATGTCGGTT. Internal WT amplicon: 1236 bp. Deletion size: 812 bp. Deletion left flank: CGCTGTATCTTTGGCGCGAAAATTTAGAAG. Deletion right flank: TTTAGCAATTTTTCAAAGCTTCTCACCATC. Insertion Sequence: CAATTTTTCAGCAATTTTAGCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C38D4.5. External left primer: TTTAAAAGCTTCAGCCGACC. External right primer:GCTGTCGTTCCGTCACTATG. Internal left primer: TCGGACGGACATTTTTCTTC. Internal right primer: ACAGAGCAACGGAAATTTGG. Internal WT amplicon: 3386 bp. Deletion size: 2724 bp. Deletion left flank: GAACAAAATGCGTGAATCTTTAGCTGATGA. Deletion right flank: AATTCCAATGTGAGTTTTTTTTTCAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71H2AR.2. External left primer: AAAACCACTCCTTTGGTCCC. External right primer: CGTTGCAATGGGGTAAGTCT. Internal left primer: CCCAATTGGCGCTACTCTAA. Internal right primer: TTTTATACAAACGAAGAAGGCCTAA. Internal WT amplicon: 1156 bp. Deletion size: 794 bp. Deletion left flank: TATGGATAGTCTGCTTCTGTTTCTATGCCA. Deletion right flank: GAATTGAAGGTGCTTCTCGAGTTTGCTGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20H11.1. External left primer: CAGCAACTCCATCAAAGCAA. External right primer: CGTTTCTGCCGATTTTTCAT. Internal left primer: AGTTGACAGAACTCCGGCAC. Internal right primer: TTTTGGCTAGAGAATCACAAAAA. Internal WT amplicon: 1279 bp. Deletion size: 472 bp. Deletion left flank: GTGCAAAAAAAACAATTTCTCCAGACCGGG. Deletion right flank: AAGGAGTTGAAGATTGATTATGAGCATCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK121.1. External left primer: AAATTGATTTTCAATGCCGC. External right primer: TCCGATGTTCGTGTTGCTTA. Internal left primer: TTCAGAAGTGTCTTGGCACG. Internal right primer: CTTTGAAGGCATCTCAACCG. Internal WT amplicon: 1154 bp. Deletion size: 470 bp. Deletion left flank: CTTAGCAAATTCTACAGTAATTCTTTAAAT. Deletion right flank: ACACATAAATCGTGGTAGGTGTGAAAACCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56F3.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3277 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATGGAACCACAGGTTGGTGT. External right primer: ATCAAGAAAGATCGATGGCG. Internal left primer: CACGGGACATCATCATCTTG. Internal right primer: GTGAGGAAACTGCTGGAGGA. Internal WT amplicon: 1110 bp. Deletion size: 568 bp. Deletion left flank: CTCTTGGTTGCTCTCTGGCGGGCTCTGACT. Deletion right flank: GGATCTTGCAATGGACTGACTTTTGAAGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C13B9.4. External left primer: CGTGGAATCATCGCTACCTT. External right primer: TTTATGCAGGCTTATTGCCC. Internal left primer: TTTACTCCTTGACGGGAACG. Internal right primer: TCAGGCGGCTTCGAGTATT. Internal WT amplicon: 1261 bp. Deletion size: 605 bp. Deletion left flank: ATCCCTAGTTGGTGCAAACGGAATTGTTTG. Deletion right flank: ATAGAGTACCAGCCGAAGTATTACAACCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (ok3432) in T09A5.8, detectable by PCR using the following primers. External left primer: CTTCCTTCGACGACTTTTCG. External right primer: CCGGGGAAACTGAGTCTCTT. Internal left primer: AGTGGCGGAGTTGGTCAT. Internal right primer: AGAACTTCGGAGCGTCGTT. Internal WT amplicon: 1373 bp. Deletion size: 475 bp. Deletion left flank: ACCGTAGCTACCGTCGCTGTCATGGTTAGA. Deletion right flank: AAATAAGACGGAATTTTCAAAAGAAAACTC. Validation: ok3432 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12D8.8. Identified by PCR, validated by CGH. External left primer: CGAATCGATCCGATCTTCAT. External right primer: GGGATCGATAATGGCTCAGA. Internal left primer: GTTTCCGGAGTTGGAACTGA. Internal right primer: TTGCGAACAACAAATCCTCA. Internal WT amplicon: 1279 bp. Deletion size: 764 bp. Deletion left flank: AAGAAATCAACACAATTTAATGTTAAAGAT. Deletion right flank: GAACCCGCTCTCTACGCTCCGCGAGCTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK418.13. External left primer: CGCGCTTTATTGAGAACCAT. External right primer: TTTCCGAGGGTACGCTTCTA. Internal left primer: GCGCGAAGTTTGAATAGGAC. Internal right primer: GCGGCCACGTAGTAGAAAAA. Internal WT amplicon: 1264 bp. Deletion size: 446 bp. Deletion left flank: GACGGAGGCGATACGGGCGGTGGCTTCATG. Deletion right flank: GCATGTTTGCTCATAGAGCTTACACCACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H27M09.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3341 homozygotes (grotty, lumpy sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTAGGTGAACCCACGAGCAT. External right primer: TGGATCAATCGTCTCCTGCT. Internal left primer: ACAGTCACGGGAAAACAGGA. Internal right primer: TGAACTTTGATATGCAACACAGAA. Internal WT amplicon: 1195 bp. Deletion size: 691 bp. Deletion left flank: TCAGCCACGCTCGTCGTATTGCCATCGCAG. Deletion right flank: ACCACCAGGAAAGAAGGGAGATGATGGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54F11.2. External left primer: AGTGGTACTGTAGGCCGGTG. External right primer: TCGGAGATCATAGGGCATTC. Internal left primer: TCCTACGCCTGTGGAAACTT. Internal right primer: TTGCATAGGCCTTCTGCTTT. Internal WT amplicon: 1216 bp. Deletion size: 472 bp. Deletion left flank: AGGATCCAACTTACCAGACCACTATCAATA. Deletion right flank: CTATGAGCAGAACATTGCAGTCAAGTACAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC581.1. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3240 homozygotes (slow-moving Unc, may be sometimes sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACGTGGTGCTTTTGGAGTT. External right primer: TCCGCTGTTTGACCTACAGA. Internal left primer: CTGTGTCGCGGTAAAAATGA. Internal right primer: GCATGACGTCGATGGTTTC. Internal WT amplicon: 1365 bp. Deletion size: 602 bp. Deletion left flank: CTTTTTACTGAAACAAATATTTTTGAAGAT. Deletion right flank: CTTTCCGATCCACTTGTTCTTCCCTATTTG. Insertion Sequence: GTAATCGATTAATTTTCAGAGCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52F12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3339 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATATGCCTCGTCCTGGAAC. External right primer: GGCCATGTTCATCAGAAGGT. Internal left primer: TTTCTTTACCACGAAGTAAGCG. Internal right primer: TCTGAATGTTTGAAAGTCGCA. Internal WT amplicon: 1354 bp. Deletion size: 696 bp. Deletion left flank: CATTGAAGTAGAGGCCAAACAACGAAATAT. Deletion right flank: TCTGAATTAAAAATGCTTAATTCAGAAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2187 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAGCCTTTTGAGAAACACG. External right primer: CATAAGAAAGCTTCGCAGGC. Internal left primer: CCCTGCCACTGTGACAATTA. Internal right primer: GGAGCCAAATGGAAGAAACA. Internal WT amplicon: 3170 bp. Deletion size: 1128 bp. Deletion left flank: ATACTGCCTGTGCGACTCCAAATGCCAACT. Deletion right flank: AGTTTTTCAGAAATTAAAAAACCTTTATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R13A5.9. External left primer: TTCACTTCCACCACCACCTT. External right primer: TTTCTGGACCATTTTGGAGC. Internal left primer: ATTCTCGCCCTTGCTTTCTC. Internal right primer: AATTTGCCAGTCGTTTCAGG. Internal WT amplicon: 1266 bp. Deletion size: 518 bp. Deletion left flank: GGATGATTTCGGAATGTATCCGAATAATCG. Deletion right flank: CGCTGAAATTAAAATAATTTATTTTGAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ok3356. Homozygous constitutive dauer deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3356 homozygotes (constitutive dauer, probably non-recovering). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGCCAAGAAGTGAAGATTCC. External right primer: ACGCTTGTAATGCCGAAAGT. Internal left primer: GCAAATGCTTCAAAAGAGCC. Internal right primer: GAGTCCGAGCAATTCTGAAAA. Internal WT amplicon: 1122 bp. Deletion size: 367 bp. Deletion left flank: AGGAACATTTCATCCGTATGGTCGTTTCTA. Deletion right flank: TTTGGAGGATTAATCGAGTTTTGAAGGTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02B12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3388 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCTTTCTTCCAGCTTGCC. External right primer: TAGGGCCAGAAAATTGAACG. Internal left primer: AAATGTAGAATTGGGCGAGC. Internal right primer: GGTAGGCGCACATACCATTT. Internal WT amplicon: 1129 bp. Deletion size: 405 bp. Deletion left flank: TCTGAATAATTTCAGGTCGTTCAACTTCCT. Deletion right flank: AAAATGGTATGTGCGCCTACCAATTGAAAA. Insertion Sequence: AAAAGGATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1287) in C06E1.8, detectable by PCR using the following primers. External left primer: CCCGCAAACAGGAAGAAATA. External right primer: CTGCTGCTCCAAAACATTGA. Internal left primer: GCACAGTTTGTTCCAATCCA. Internal right primer: TTCTTCTTCCTCCTCCGTCA. Internal WT amplicon: 2185 bp. Deletion size: 1044 bp. Deletion left flank: TGTTGTTGCTGTCATTGTTGTTAGTGGCAG. Deletion right flank: AATCATTATAAAAGTAAGAACCTAATCAGA. Insertion Sequence: CAG. Validation: gk1287 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R10E11.8. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok513 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1010.2, ZK1010.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2028 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCCAATTCAGGTCGTTCC. External right primer: TCATATCGAATTCATCGGCA. Internal left primer: TCCAAATGTTTTCCCGAGAG. Internal right primer: CTGGACGCTTGTTCAGCATA. Internal WT amplicon: 2149 bp. Deletion size: 896 bp. Deletion left flank: TGAAGCAACTGGGCGTCTCTTCTTCATCTT. Deletion right flank: GATTTTTCTTTAGAGACTAGTTTCAAAGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C05D10.2. External left primer: CAACTATTCTAGAGCCGCCG. External right primer: GCACGACTCTTATCTTCGCC. Internal left primer: ATACTCGGAGCGTGAGTCGT. Internal right primer: TCCGGAAGTGGTGGATAAAC. Internal WT amplicon: 2660 bp. Deletion size: 1407 bp. Deletion left flank: GTCATGATCATCATCATATTTTTATTATCA. Deletion right flank: GCTCCTCAAAAACGATTAACCGTTGAACAA. Insertion Sequence: TTTTTATTATATATTATCATTTTTATTATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C45G9.1. External left primer: GAAGGCCGAATCAAATGAAA. External right primer: AAACTGCGAGAAAATCCGAA. Internal left primer: CCTTTGCGCGTAAGATATGG. Internal right primer: ATCAATTAGGCTTCGGGCTT. Internal WT amplicon: 1743 bp. Deletion size: 1228 bp. Deletion left flank: TCTCCTATATGGTCATGACGTTATTGGGGA. Deletion right flank: TCTTATGGAAAACAAAATTTAATATTCTAT. Insertion Sequence: TGGAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F29C12.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3372 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACGAACGGAAAACAACG. External right primer: GTGCATTTTTATTCCCGCAT. Internal left primer: CGCGTACTCCTCTCGGATAA. Internal right primer: TGGGACATATTAGCACCACG. Internal WT amplicon: 1208 bp. Deletion size: 371 bp. Deletion left flank: TTATTTTTAAATTATTTTAATAGTTTTTTT. Deletion right flank: ATTATTGATACACCAGGCCACGTGGATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39G10AR.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2378 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGCGAAAACAAAACAATTT. External right primer: TGAGGAAATTTCGGCTCATT. Internal left primer: TTTCCCAGAAAATGCCACTC. Internal right primer: GCAACTCTGGCATGCTTTTT. Internal WT amplicon: 2881 bp. Deletion size: 2093 bp. Deletion left flank: CAGCGGTTGTGACAAAGAAAAGTGTGCGAA. Deletion right flank: TTGCAACGGAGAATCGACCGGCTCCTGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R06C1.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3308 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAGCTGGGACTTCGTTG. External right primer: TTTTGGCTGCTCGCTTTTAT. Internal left primer: GGGTTTCTAGCGATTTTTCCA. Internal right primer: ACGATTTTCGTGCCAATTTC. Internal WT amplicon: 1322 bp. Deletion size: 556 bp. Deletion left flank: TTGGCCTGCTCGGGGAGCACAAGAGCTGTG. Deletion right flank: CTGTAGGTAAAGTGCTTCTATCCAGAATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y110A7A.8. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1094 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. (Note: in this strain hT2[qIs48] occasionally recombines such that the GFP and its associated lethality are lost and the non-GFP hT2 left behind still carries the bli-4 mutation of the original hT2. Such a recombination event results in a viable non-GFP animal that is no longer gk1094/hT2[qIs48] but is gk1094/hT2.) External left primer: TTTCATTCTCTTCGCGACCT. External right primer: CACACTCCAGCACTGGAAAA. Internal left primer: TGCAGCAATGAAGAGAAACG. Internal right primer: TTTCGCATATGGGTCGAAAT. Internal WT amplicon: 2229 bp. Deletion size: 1953 bp. Deletion left flank: AGCGAACTGCAGCAATGAAGAGAAACGAGA. Deletion right flank: ATATATTTATTTGTTACTTTCCTCTTCCTG. Insertion Sequence: GAACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25A8.5, F45H7.2. The allele gk1224 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: GTGGAGCGTTCGGTACATTT. External right primer: TCACACCCCTGACAGGTACA. Internal left primer: AACGGAACCGTTGAGAATTG. Internal right primer: GCCGCCTCACAAGTTAGTTT. Internal WT amplicon: 2303 bp. Deletion size: 1432 bp. Deletion left flank: TTTCCAACGAAAATGTGACTTTTTCAGGAA. Deletion right flank: ATCTACCCATCTTGAGATCAAAACTTTCGA. Insertion Sequence: CAATTTTATTTTAAAAAATGCTCTGTGCCGCTTTTGTCGATACAACTTCTGAAATTTTC AAAACCACCGCGGTGCCTCCCAGTAGGACTTCAAAAATTG. The allele gk3062 was identified by CGH but not confirmed by PCR. Left flanking probe: GAAAAAGATGGATCTAAGATCCACTAATAAGTGAGTACACATACAGTGTG. Right flanking probe: GAAATTTGATTCCGGACCGTATGTACGATGATCTCGATGACCTACCTCTG. Left deleted probe: ATCTACTGTTTGCAGACGACCAAAAGAAACACGTGGCAGACCTGCTCCAA. Right deleted probe: GTTATTTTGTTTTTATCAGCTTCAAGGCGGTCTACATCTGCCTTGCGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F21C3.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3600 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: ATTTCAACGCTGCTGGAGAC. Internal left primer: ATGATGGCTGACTTTGAGCA. Internal right primer: TGCAAAGTTGGTTTTCACGA. Internal WT amplicon: 1193 bp. Deletion size: 445 bp. Deletion left flank: ATTTTAAAACGTTTAAAGGTAAAATTTATT. Deletion right flank: AAAAGAAGTGAAAGAAAACAAAATTGTGTT. Insertion Sequence: AT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y43F4B.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2481 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTCCCATGAAGTTTGTCGT. External right primer: ATTGTGCGTGAACTCTGACG. Internal left primer: TTCTCATCGACCCGATTTTC. Internal right primer: TTTGATTTCAAAAGCCTCCG. Internal WT amplicon: 3279 bp. Deletion size: 1984 bp. Deletion left flank: AGACAAAATAGGACAATGGGAAAAACAGAC. Deletion right flank: GGTGTTCATGATTCTTTGGAACAACGCACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807