More Fields
Strain Species Genotype
VC1752 C. elegans Y23H5A.2&cars-1(ok2280) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y23H5A.2, Y23H5A.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2280 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCCATGGAAAAGATCCGAA. External right primer: TGGAACGGAGGTAAAACGAC. Internal left primer: ACCCCATATCGTGTCAATGG. Internal right primer: ACGGATTCAAGATCTGGTGG. Internal WT amplicon: 2132 bp. Deletion size: 475 bp. Deletion left flank: CAACGCGACCGCCGAAGCCGCACAATTCTG. Deletion right flank: TTCTCCGGATCTCGAAGAAAAACGCCGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1756 C. elegans Y39E4B.5(gk848) III. Show Description
Y39E4B.5. External left primer: AGCAGAAACTGTGCGAACCT. External right primer: CATTCCGAGAACACACATCG. Internal left primer: TAGAGCGAATAAAGCCCGAA. Internal right primer: CTAGAGGCGACGTTTCTTGG. Internal WT amplicon: 2038 bp. Deletion size: 753 bp. Deletion left flank: GAAAATACGATTGCTCTGTTCCAGGTGGAT. Deletion right flank: GGAAGAAAGTTCGGCTACATCGTCTGCGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1763 C. elegans F59B2.8(ok2150) III. Show Description
F59B2.8. External left primer: TATTGCCCGTGTGTGTGTTT. External right primer: ACAAGGATGCTTTACCCGTG. Internal left primer: TTCTTCGTCTCCGCACTCTT. Internal right primer: TCTCGTCTCTCACCCGTTCT. Internal WT amplicon: 2249 bp. Deletion size: 1073 bp. Deletion left flank: CTAAAATCTTTTTGGCTTTGGCTACTCCTA. Deletion right flank: CACCAGTGGTAGTTTTGTAATAGGAAACGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1774 C. elegans nekl-2(gk841) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZC581.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk841 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGCCCTCTAAATTGTCA. External right primer: GCAGATTTCGTTCCAAGCTC. Internal left primer: TCTTTGTTAGCCATTTCCGC. Internal right primer: GAACAGTCTTTCGGCGATTC. Internal WT amplicon: 1654 bp. Deletion size: 354 bp. Deletion left flank: TTCAAATGGACAATTATGAAAAAGTGCGTG. Deletion right flank: TATTGATTCTTTTATTATGGATAATCAACT. Insertion Sequence: ATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1787 C. elegans C17E4.6(ok2296) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C17E4.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2296 homozygotes (viable Unc, sickly, BMD, vulval defects). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACGACCTCTTGGACGAAAT. External right primer: CCAACCCCAACTGCCTACTA. Internal left primer: AGTGCGAGTGCGTTACACTG. Internal right primer: GGAGCCATAGTCGAGAGACG. Internal WT amplicon: 2597 bp. Deletion size: 1233 bp. Deletion left flank: GATGATATTCTAGCTAAGAACAAGAAATGG. Deletion right flank: TCAACGACGACAACTCTACCAGTCAACGTC. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1789 C. elegans nduf-2.2(ok2397) III. Show Description
T26A5.3. External left primer: CGAGCATCTTTTGATGCAGA. External right primer: TGCTGTGGTCCAAAGTTGAG. Internal left primer: CTTTCATGAGCCGAGTCACA. Internal right primer: ATTTGATCGTCGAAATCGGA. Internal WT amplicon: 2684 bp. Deletion size: 910 bp. Deletion left flank: AGTTTCAAAGAGTGGAGGAATGGGTGGCAT. Deletion right flank: ATGCTTTCGCGATCATTGCATCCTCTTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1791 C. elegans ttr-1(ok2250) III. Show Description
K03H1.6. Superficially wild type. External left primer: AATTGGCCGTCTTCAATCAG. External right primer: CCCAGGTGGTAAAATGGATG. Internal left primer: GCGGTGAGATTTTAAAACGG. Internal right primer: GGCATTACCTCGCCAATAGA. Internal WT amplicon: 3092 bp. Deletion size: 1281 bp. Deletion left flank: CAACGTCAACTCCGTGTCGACATTCCAAAA. Deletion right flank: AAAAAATCAATGTTCTTCAGTTTTTTATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1793 C. elegans cTe154X.1(gk3143) III; ZK185.2(gk804) IV. Show Description
This strain is homozygous for a deletion (gk804) in ZK185.2, detectable by PCR using the following primers. External left primer: AACCAAACGATGTCCCTGAC. External right primer: TCGGAAATGAAAACCCCATA. Internal left primer: TATTAGAGGCATATCGGCGG. Internal right primer: ATCACACCGGCGAGAATTAG. Internal WT amplicon: 1842 bp. Deletion size: 780 bp. Deletion left flank: ACTTGAATTTTTCCAGTAATTTTAGTTTTG. Deletion right flank: CTCTACCGGAGTTTGAAGGCACTTATTCGT. Validation: No CGH probes for gk804. Other deletion (gk3143) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1797 C. elegans sft-1(ok2277)/sC1 [dpy-1(s2170)] III. Show Description
H06I04.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2277 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGACAACTCCTTGCCTCACC. External right primer: ATTCCCCGCCATTTATTACC. Internal left primer: CAAACAATCCCAAATTCTCG. Internal right primer: AGCTACAGTAACCCGCGAAA. Internal WT amplicon: 3080 bp. Deletion size: 1808 bp. Deletion left flank: AAAAAAAATTTCTAAATTTATTCCCAATTT. Deletion right flank: TCAAAAAATCAGGGGTTCGTTGTGAAAAAT. Insertion Sequence: TCTTCTAAATTTATTCCCAATTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC180 C. elegans +/eT1 III; tnt-4(gk136)/eT1 V. Show Description
T08B1.2. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk136 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1801 C. elegans cnx-1(ok2234) III. Show Description
ZK632.6. Superficially wild type. External left primer: ACCTCACATGGTGGAAAAGC. External right primer: ACAGACGCGCTCTAGCAAAT. Internal left primer: AGTTGGCTTCACTGGCTCAT. Internal right primer: CACAATGCCCCTCATTTTCT. Internal WT amplicon: 2586 bp. Deletion size: 1412 bp. Deletion left flank: CGTCTTGCGGTTCTGGATTGCTCTGGGAAC. Deletion right flank: GTTAATTGGATTTTTATAACGGAAAATTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1808 C. elegans grl-25(gk822) III; daf-3(gk3129) X. Show Description
This strain is homozygous for a deletion (gk822) in ZK634.8, detectable by PCR using the following primers. External left primer: GCATCATTCTTTCAGTCGCA. External right primer: TGAGCTCGACGATGAATCAC. Internal left primer: CCACGTTTCGTCATTCCTCT. Internal right primer: GAGGATTCACCACCTCCTGA. Internal WT amplicon: 1922 bp. Deletion size: 1185 bp. Deletion left flank: GCTGCGGAGGTGGCGGAGGATGTGCTCCAC. Deletion right flank: AAACATATCAACGAAGATTACATTATTCAG. Validation: gk822 passed by CGH. Other deletion (gk3129) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1809 C. elegans Y48A6B.8(gk813) III. Show Description
Y48A6B.8. External left primer: ACACGTAGGAAACCCGTCAG. External right primer: AATGCTCCATTTTGTGCTCC. Internal left primer: ATCCAGCGTTCAACTGCTTT. Internal right primer: TTTCTGCATACTTTCGGCAA. Internal WT amplicon: 2212 bp. Deletion size: 1719 bp. Deletion left flank: TGGATCTCTGAAAGAGTTCCATTTTCTAAT. Deletion right flank: ATTATAAAAATGTTGAATTTTTTAAATTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1818 C. elegans T04A8.3&tag-243(ok1855) III. Show Description
T04A8.4, T04A8.3. Superficially wild type. External left primer: CCTTGAACACCCTTCGAAAA. External right primer: TCTGGGAGTCGTTCCAAAAC. Internal left primer: AGCGGATTCCAAAATCATCA. Internal right primer: GTCAGCTGGTCTCGTTGTGA. Internal WT amplicon: 2106 bp. Deletion size: 1416 bp. Deletion left flank: TCTGTACCTTGTATCCATTTCTGGCACGAT. Deletion right flank: GCCTGAAAATTCAGTTAATTTAGACTTTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1825 C. elegans F44E2.8&F44E2.9(ok2134) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F44E2.8, F44E2.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2134 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGCTGGTTGGTTTCACCAT. External right primer: ATATGTGGAACTTGCCGGAG. Internal left primer: CATTGGAGAGAGCTTAGGCG. Internal right primer: TCGTTTTTAAATTTCCGCCA. Internal WT amplicon: 2111 bp. Deletion size: 1195 bp. Deletion left flank: TTTTTGTCGAACTTCATTCTTTACTTTACT. Deletion right flank: GGAAATAAAATCGATAAAAACTTTAAAATT. Insertion Sequence: CACGACTTCCTGTTTCTTCAGAAAAACTCTGAATGGCCGTTTCCCATTTTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1827 C. elegans rbc-2(ok2313)/sC1 [dpy-1(s2170)] III. Show Description
Y54F10AM.10. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2313 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGGTTGGCGACTTTTCAC. External right primer: AGGGGGAACTGTCGGTTAGT. Internal left primer: TACAAATCCCCGTCCCAATA. Internal right primer: AGAAGTCGAGGTGGCAGGTA. Internal WT amplicon: 3304 bp. Deletion size: 2261 bp. Deletion left flank: GCGATAATTTGTTGTTTTTACTGAAAATTT. Deletion right flank: TCGAGGGTGGCTACTGTATTCTCGCGGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1828 C. elegans tag-164&abcf-2(ok2388) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y76A2A.1, T27E9.7. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2388 homozygotes (small, sickly, tends to die out but populations are possible to maintain). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAGCAGTTGATAGCCTCG. External right primer: CGTCGCTTTTTCCGTGTATT. Internal left primer: ATAGCTGTTTCATCGGGCAC. Internal right primer: AATTTAGGGTACCCCATCCG. Internal WT amplicon: 3031 bp. Deletion size: 1245 bp. Deletion left flank: CAGGCTAAATTAGCATATTTACACAGACGA. Deletion right flank: CCGCTTGAAGAGCAGTTTTCTCTGAAGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1831 C. elegans vha-16(ok2332) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C30F8.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2332 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAGATCCAGGAAGGAATGA. External right primer: CGAAAATAATTGCAGCCCAT. Internal left primer: TTGCGAAGCCGATTTAGTTT. Internal right primer: TTCTTTCGCCTCCTTTTTCA. Internal WT amplicon: 2112 bp. Deletion size: 831 bp. Deletion left flank: TTTCGAAAAACCAGGCCGTAAACTGACAGC. Deletion right flank: TTTTTTTTCAAATTAAATTATTATACAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1833 C. elegans sem-2(ok2422) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C32E12.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2422 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGAATGAAAACTGGCTCG. External right primer: ATATGATGCCGCCGATTAAC. Internal left primer: CAATCGCTTGGATTTGTTGA. Internal right primer: CAATTGCAGTAGCCTCATCG. Internal WT amplicon: 3044 bp. Deletion size: 2389 bp. Deletion left flank: AAGTTGGTGCTGGTGATGGTGCGAAGTGGT. Deletion right flank: CCAGAAGTCGATGAGGCTACTGCAATTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1835 C. elegans T28D6.6&pen-2(ok2449) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T28D6.9, T28D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2449 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGTCGTTTCTCGCTTTTT. External right primer: CTACGTGGAAACCGTGGAGT. Internal left primer: CCCGTGTGCCTGTAAGTTTT. Internal right primer: CTTAAAGGCGCATATCCCAA. Internal WT amplicon: 2150 bp. Deletion size: 1227 bp. Deletion left flank: TCCAGATATTGCCATAAATTTAGAGAAAAT. Deletion right flank: TTCGATTTTTTTCTGAAAAATTCAAAAATT. Insertion Sequence: ATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1843 C. elegans Y48A6B.8(gk895) III. Show Description
Y48A6B.8. External left primer: ACACGTAGGAAACCCGTCAG. External right primer: AATGCTCCATTTTGTGCTCC. Internal left primer: ATCCAGCGTTCAACTGCTTT. Internal right primer: TTTCTGCATACTTTCGGCAA. Internal WT amplicon: 2212 bp. Deletion size: 653 bp. Deletion left flank: TTATAGTGTTCTCTCCAGAATAAAAGTTTT. Deletion right flank: GTATCAGAATATCTAAAGTTGGGTGAAACT. Insertion Sequence: TC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1846 C. elegans abcf-3(ok2237) III. Show Description
F42A10.1. External left primer: TCCGGTTTTCATCGTCTTTC. External right primer: ATGCTTGCTCGTTGTCTGTG. Internal left primer: TATCTCACGGCCACTTTTCC. Internal right primer: AACCGAATGCGAAACAAAAC. Internal WT amplicon: 2429 bp. Deletion size: 1913 bp. Deletion left flank: ATCTTTGCGAGGTTGGAGCTAAGAATGCTT. Deletion right flank: TTTTCAAAAAATATTCATTTTTTCCTAGAA. Insertion Sequence: TTTTTTCAAAAAATATTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1847 C. elegans T28D6.6&pen-2(ok2395) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T28D6.9, T28D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2395 homozygotes (grotty sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGTCGTTTCTCGCTTTTT. External right primer: CTACGTGGAAACCGTGGAGT. Internal left primer: CCCGTGTGCCTGTAAGTTTT. Internal right primer: CTTAAAGGCGCATATCCCAA. Internal WT amplicon: 2150 bp. Deletion size: 832 bp. Deletion left flank: CGGCCTCGATATCCGCGATTTTTTGCAAAA. Deletion right flank: GATTTTTTTCTGAAAAATTCAAAAATTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1848 C. elegans mom-5(gk812) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T23D8.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk812 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGTGTGTGCTCCGTTCTCTC. External right primer: AATCGGTCGAACTGGATACG. Internal left primer: GCACTTGGAACCAATGTCAA. Internal right primer: AATGAACATTCAGGAAGGCG. Internal WT amplicon: 1742 bp. Deletion size: 567 bp. Deletion left flank: TTTTAGCTATTTACTTAAGTTCGGTTTTTT. Deletion right flank: AAAAGTTTGGATTTCAATGGCCAGATCAAT. Insertion Sequence: GAAAAAGTTTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1858 C. elegans lin-39(gk893) III. Show Description
C07H6.7. External left primer: GGACCCGAAATGTTTCAAGA. External right primer: CCGTTATTCTGCCGATCATT. Internal left primer: TCAGCGCTTTGCAGAAACTA. Internal right primer: CGAAATTGCTGAGTTCGTCA. Internal WT amplicon: 1900 bp. Deletion size: 1206 bp. Deletion left flank: GGAGCTTCCTAACTATAACGCTCCAACTCT. Deletion right flank: GCATTCATCAAAAGGAATTAGATCAACCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1863 C. elegans ZK418.9(ok2248) III. Show Description
ZK418.9. External left primer: AATACTTCGTCGCAGTGCCT. External right primer: ACTGCCAATTTTTCGAATGG. Internal left primer: AAACGAGATCGGCACAATTC. Internal right primer: TGGTGGCATTGGAACACTAA. Internal WT amplicon: 2302 bp. Deletion size: 966 bp. Deletion left flank: ACACTGGCTTGTGGTTGTTGCATAGGATTC. Deletion right flank: GAAGTGGCTTCGGCTGGCCAGTTGCAGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1864 C. elegans Y49E10(ok2316) III. Show Description
Y49E10. External left primer: ACCGCACCACATATGATTGA. External right primer: GTCGTCGTCGGAACACATAA. Internal left primer: AATGCGCGCGCTTAGTAG. Internal right primer: TCACCTGTTTTAGGCATTTTCA. Internal WT amplicon: 3186 bp. Deletion size: 1053 bp. Deletion left flank: TCGAGAGTACAAAATAAGCCTGTGGAAAAA. Deletion right flank: TCCAGATCTAAATAAAGGTTTATAACAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1868 C. elegans F39H11.1(ok2247) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F39H11.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2247 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACTTCGTCGTGAGCATTCA. External right primer: ATTCTTAACCGTGCGACACC. Internal left primer: CATCATAAAGCATGTGCGCT. Internal right primer: TGTCGCTGCTCAGAAGAAGA. Internal WT amplicon: 2222 bp. Deletion size: approximately 400 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1875 C. elegans dnc-2(ok2249) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C28H8.12. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2249 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCACTGACCCGATTTCTTG. External right primer: AACAATCGAACGTTTTTGCC. Internal left primer: AAATGTGATAGTCCACCGGC. Internal right primer: CCGGTAGAGCGCAGTAACTC. Internal WT amplicon: 1224 bp. Deletion size: 707 bp. Deletion left flank: TCAAGTTTGGTAAGCATCATATTCAAACGT. Deletion right flank: TTTTCAGGTTCACTTTTTTGAACTTGACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1885 C. elegans spe-11(ok2213) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F48C1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2213 homozygotes (sterile, lays unfertilized oocytes). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTGGGTGCAAAACAGGTTC. External right primer: GGCTTACAGCTCTTGGTGGA. Internal left primer: GACCAAATTGAAGCGCATTT. Internal right primer: GAACATTTTTCCGTCAACCG. Internal WT amplicon: 2133 bp. Deletion size: 1051 bp. Deletion left flank: TGGGATGAATTTATGTGCAACATGCTCGTA. Deletion right flank: ACATTTTTATCATTATAACGAATATTCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1886 C. elegans sbp-1(ok2363) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y47D3B.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2363 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATGCCACTTGTTCAGGGTT. External right primer: GCATGAGAGTTACACGCGAA. Internal left primer: TGGAGACATGTACCCGTTGA. Internal right primer: ATCACACGAGCCCTCAGAAC. Internal WT amplicon: 2759 bp. Deletion size: 1315 bp. Deletion left flank: TGCTTGATAAGACCCCCCTCTACTGCAACA. Deletion right flank: CAAAATCAGAACTCAAAAGCAAAGAAGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1890 C. elegans tbx-7(gk1033) III. Show Description
ZK328.8. External left primer: GCTGCTCCACCTTTTGTTTC. External right primer: ATCACAGGGTGCATCTTTCC. Internal left primer: ACCCGAACTATCAGCTCGAA. Internal right primer: GCGTATGCACTCGAAGTGTG. Internal WT amplicon: 1994 bp. Deletion size: 488 bp. Deletion left flank: CTACTGATATCATTTCCATTATTATTGTGT. Deletion right flank: GCTCCATAAATTTCTATTTACCAGCTCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1895 C. elegans +/mT1 II; cyk-1(ok2300)/mT1 [dpy-10(e128)] III. Show Description
F11H8.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2300 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCAGCATTTCCTGTAGCACG. External right primer: CAAGATAATCAGGCGAAGGG. Internal left primer: CGGCTTCCTTTCTTGTTGAG. Internal right primer: CGGAATGCAAGCAGGATATT. Internal WT amplicon: 3243 bp. Deletion size: 826 bp. Deletion left flank: TTCAAAAATGTTCGGAATCCTTCAGATGCT. Deletion right flank: GCGGGGGTCCTCCGGTGATTGGAGGAAGAC. Insertion Sequence: TCGGAATCCTTCAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1896 C. elegans ckb-3(ok2310) III. Show Description
B0285.10. External left primer: ACTATTCGTTGGCAACTCGC. External right primer: TGAACCGAAGACGAGACTCC. Internal left primer: GGACTCCGTAGCTGTTCTACAAA. Internal right primer: GGCCCGGACTCAGTAAAGTC. Internal WT amplicon: 3214 bp. Deletion size: 2055 bp. Deletion left flank: ATTAACATTTTGAGCTATTGGCAAAATAAA. Deletion right flank: CTTCCAAACTAAATTTGTCGAAACAAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1898 C. elegans Y66D12A.24&tin-10(ok2400) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y66D12A.22, Y66D12A.24. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2400 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGCTCACTTGACACTTTCG. External right primer: TGGGGAAAATCGAAAACTTG. Internal left primer: CTGTGCAATTTGTGATTGCC. Internal right primer: ATATGTACCGCCGAATGACC. Internal WT amplicon: 2686 bp. Deletion size: 1690 bp. Deletion left flank: TTCATTTTGGCTAATTTCTCAGTAAAAATT. Deletion right flank: TTCGATTTAAAAAAAATCGATTTTTTTCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1900 C. elegans T20H4.2(ok2547) III. Show Description
T20H4.2. External left primer: AGATGGGAGCCAAGACGTTA. External right primer: GACGTTGCCTTCGACATCTT. Internal left primer: TCATGCACATACAATGCCAA. Internal right primer: CTACCAAGTCACGCCCACTT. Internal WT amplicon: 2220 bp. Deletion size: 1394 bp. Deletion left flank: GGGGAATGATGGAAAGAACATTTACACTTT. Deletion right flank: ATGGGGTTAGTAATTCACCATTCGAATCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1906 C. elegans ceh-45(gk1015) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK993.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1015 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAATGGAGAGACGGGTGTGT. External right primer: TTGAAAATTGTGAAGCTGCG. Internal left primer: GGCGCCAGAGTTTGATCTAC. Internal right primer: AGGTTGATGTGGACGGAGAG. Internal WT amplicon: 1907 bp. Deletion size: 1113 bp. Deletion left flank: CAAAATCTTGGTAGTCTAGAAAACCCCAAT. Deletion right flank: CATGGTGTCCTAGGAATATTTTTAAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1910 C. elegans ncl-1(ok2555) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK112.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2555 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGCCAATATGGGACTCTC. External right primer: GGATGATACGGCTTTGTGCT. Internal left primer: AGCCATTCCTGTTCCAAATG. Internal right primer: GATTGGACTTCCTCCGTGAA. Internal WT amplicon: 3295 bp. Deletion size: 1644 bp. Deletion left flank: AACAAATGCTCAAAATGGAGCAATTGATTG. Deletion right flank: TTCTCTCGTAGATTGATGTCCTTCGCGTCG. Insertion Sequence: AATTCTCAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1930 C. elegans mrps-30(ok2469) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0511.8. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2469 homozygotes (late larval arrest or sterile adult, Unc, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAAATGCCTATCGAGACC. External right primer: CCCGAATCTCCTAATGCTCA. Internal left primer: AGCATTTTTCTGCGTCCCTA. Internal right primer: ACACGCCCTGCTACTGATCT. Internal WT amplicon: 2582 bp. Deletion size: 1317 bp. Deletion left flank: GAACACTCAAATATTGTCCATTTTTATCAC. Deletion right flank: GTGTGTCTTCATCAGAAAAGTTGATTCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1932 C. elegans T07A5.5&unc-69(ok2448) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T07A5.6, T07A5.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2448 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACGTGTAACCACTTCTCGCC. External right primer: CTTCATCGATCGGCTTTTGT. Internal left primer: CGGCTGTGAACTCATGACATA. Internal right primer: ATTCAAAGCTCGAGCCAAAA. Internal WT amplicon: 2903 bp. Deletion size: 1464 bp. Deletion left flank: GAGCATGAGCATCGCGATTCCAAGAATGTT. Deletion right flank: ATATTTAGTGTAGTAAAACTGTTACGAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC194 C. elegans cua-1(gk107) III. Show Description
Y76A2A.2. Slow-growing, otherwise superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1946 C. elegans pbs-6&cids-1(ok2511) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C02F5.4, C02F5.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2511 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAGCGGTACTTGTGG. External right primer: CTTTCCTGCATCAAGCATCA. Internal left primer: TTTCTTCAATTGGAGGACATCT. Internal right primer: ATTCCAGGAAGATCGAGCAA. Internal WT amplicon: 2526 bp. Deletion size: 1604 bp. Deletion left flank: AATACTGGCTTACAAAATTTGAATCTTCTC. Deletion right flank: GAAGATCGAATCAAGGCAGATTTGTTAGAG. Insertion Sequence: GAATCAAGGCAGATTTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1947 C. elegans nuo-4(ok2533) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K04G7.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2533 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACCCAAACGTGGCAATA. External right primer: TTGTTAAGACCATCATGCCG. Internal left primer: AAAAGTGTGCGTGGGGTAAT. Internal right primer: GTTCCATGAGCAAATTGGGA. Internal WT amplicon: 3154 bp. Deletion size: 1369 bp. Deletion left flank: TATGTCTTTCAGTATATCAAAATTAAAAAT. Deletion right flank: ATGAACAACTCCTCTGACTTGATTTGAGAG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1948 C. elegans R151.8(gk1047) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R151.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1047 homozygotes (sterile, does not lay eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGTGGTCTTCTTCTTCTG. External right primer: AGTTCTTCTCGACGACGCAT. Internal left primer: GAGATGCATGTCGTGTCGAT. Internal right primer: ATTGTTTCAGCACGGGAAAG. Internal WT amplicon: 2188 bp. Deletion size: 1135 bp. Deletion left flank: GGTTCTTCTCGGAATTATTGTAGTTTTTGG. Deletion right flank: GTAGAATCTCCTGCCAATGACCATTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1951 C. elegans gcy-29(ok2475)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
C04H5.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2475 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGCCTACGTGGCAAGTACA. External right primer: AAAATGACTCACGAAACGGG. Internal left primer: TGCACGTGGCAAGGTATCTA. Internal right primer: TGCAAAAATGTTGGAGAGCA. Internal WT amplicon: 3309 bp. Deletion size: 1504 bp. Deletion left flank: TTGCAAATTCGGCAGAAGTTGCAGTGTATG. Deletion right flank: TTCAAAATGAACTTCCATACACTTACCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1955 C. elegans lin-12(ok2215) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R107.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2215 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCTTTTCTCGCAGCTCCA. External right primer: CATACATTTGCGTGTGTCCC. Internal left primer: GGGCTGTCATTCCGTTTCTA. Internal right primer: AAACCTGGGAACACATCGAC. Internal WT amplicon: 3327 bp. Deletion size: 1227 bp. Deletion left flank: ATTAATTCTGTTGGTGTGGTTTGGTTTTAT. Deletion right flank: GATTTCTAGAAAACAAACTGGTTGCTTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1957 C. elegans sfxn-1.2(gk3039) II; flp-14(gk1055) III. Show Description
Y37D8A.15, F37H8.4. The allele gk1055 was identified by PCR screening, has been validated by CGH analysis, and can be detected with the following PCR primers. External left primer: CGGCAAGCCTAGTAGGTAGAC. External right primer: CGGAGAGCAATGTTGAGTCCTC. Internal left primer: CCTTTGCCAGTTTTTTCCCTTTGG. Internal right primer: TTCTTACAGGCAATGGCTGGAC. Internal WT amplicon: 2702 bp. Deletion size: 652 bp. Deletion left flank: GAAAAACGAAAATTGGCAGTAGGCAGGCAG. Deletion right flank: ACAGAGAGTAGGTAGACAATAAGCAGGCAA. The allele gk3039 was identified by CGH and not confirmed by PCR. Left flanking probe: TGTTAAATATTGGCCAGAGTTGACTCAATCTTTAGTTAATTTGGCGTAGT. Right flanking probe: CATCTGCCGAATTTTCCTTTATAACATTCCAGAACAAGAACAGTATTGCT. Left deleted probe: ACAGTTTCAGATGCCCGCCAACATGCTCATCAACGGAATGCTCTTGAGCC. Right deleted probe: GAGCTATGGCTGCTGCTCTGTCACTGAATGCGATGGTTAAGGTAAACAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1959 C. elegans B0285.6(ok2312) III. Show Description
B0285.6. External left primer: TGAGCTCCAGAATTCCAGGT. External right primer: CCTTATCCATTTTCGGCTCA. Internal left primer: TGAGCTCGCAGATGAGAGAA. Internal right primer: TCTTTGAGCCACGTCACAAC. Internal WT amplicon: 3197 bp. Deletion size: 1459 bp. Deletion left flank: GCTGTGCATTGATGGCTCCGATTGCCTATG. Deletion right flank: GACCATCATTCTCATTTATGCTTCCGATGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1961 C. elegans F26H9.8(ok2510) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26H9.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2510 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAACATCCCATCCCGAATA. External right primer: CCATTTCACGAATTTCGGTC. Internal left primer: GTGACCCTTCGAAAAGTGGA. Internal right primer: TTTCAGTTTTTGGCACGTTTT. Internal WT amplicon: 1143 bp. Deletion size: 783 bp. Deletion left flank: CAAGTGGAGGTCATCCTCGATTTTGGCCGA. Deletion right flank: CAAAATTCTAAAAAATCGGCACTTGGAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1962 C. elegans pbs-6&cids-1(ok2516) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C02F5.4, C02F5.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2516 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAGCGGTACTTGTGG. External right primer: CTTTCCTGCATCAAGCATCA. Internal left primer: TTTCTTCAATTGGAGGACATCT. Internal right primer: ATTCCAGGAAGATCGAGCAA. Internal WT amplicon: 2526 bp. Deletion size: 1268 bp. Deletion left flank: GTGGTGAGGATGATGTTATCATTCCTGAAT. Deletion right flank: CGTTGAAGAAGCGAAAAAGAATGCACAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807