Search Strains

F10G7.2. External left primer: AGAACTTTGTCGGATCGATTGT. External right primer: TCTCCGTACTCCCAAATGTTCT. Internal left primer: AAAGAGACTTCGCTTGTGGAAG. Internal right primer: ACCTTCTTGTTTCCACTGTCGT. Internal WT amplicon: 1729 bp. Deletion size: 878 bp. Deletion left flank: AACAACTTTATAAAATTGTATTTTTTTTTT. Deletion right flank: ACGTCCAACTCACTTCTGATGCTTTCGCCC. This strain was provided by the Hutter Lab at Simon Fraser University (Burnaby, BC), which should be acknowledged in any publications resulting from its use.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1432 [hlh-10::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1583 [hlh-4::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx37 [ngn-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1566 [lin-32::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx40 [cnd-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx36 [hlh-19::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwIs19 [hlh-6::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1601 [hlh-8::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1546 [hlh-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1556 [hlh-12::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx42 [hlh-15::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wyEx915 [hlh-17p::mCherry + unc-122p::GFP]. Low penetrance backwards coiler. This strain was produced by crossing TV2394 with N2 to remove wyIs45.

Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:TCAAAAAAAAACTTCAAT / ATTTTTATGGTATCTTAC...CGAATCTCTTCAAGCAAT / TGGTACTATCTCGATGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are: ATTCATATTTCGATTAATAAAATTACCAAACA / CAATCCAACATAA...ATGGATACGCAGTA / AGAACAATATATGAACGATCGAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Male-female strain. Reference WBG 11(4):89. See also WBPaper00001874. May crawl off the plates. Isolated by Bill Fixsen at a rest area on the turnpike in Conn. Previously called WS9-6 and C. vulgaris NH and C. vulgariensis by the CGC. Walter Sudhaus has tentatively described this strain as C. remanei ssp. vulgaris; this description is not official and is contigent upon its being published. See WBPaper00002633.

yfSi1 [nspf-1p::nspf-1::6xHis::tbb-2 3' UTR + loxP, II:8420157]. C-terminal 6xHis-tagged NSPF-1 allows visualization of NSPF seminal fluid protein localization in males and hermaphrodites. Transgene inserted into ttTi5650 MosSCI site (II:8420157) using CRISPR/Cas9. Reference: Kasimatis KR, et al. (2022) No evidence of sexual conflict for a novel sperm-derived seminal fluid protein in Caenorhabditis nematodes. bioRxiv doi: https://doi.org/10.1101/2022.09.22.509081

B0228.5 Homozygous. Exhibits slightly shortened lifespan compared to wild-type. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/ Reference: Miranda-Vizuete A, et al. FEBS Lett. 2006 Jan 23;580(2):484-90.

nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT and segregate WT, Dpy Sterile, and tm3574 homozygotes. gsr-1(tm3574) is embryonic lethal. gsr-1(m+,z-) animals are viable and reach adulthood with no visible phenotype and lay eggs that invariably arrest at the pregastrula stage; they are slightly short-lived, have increased mitochondrial fragmentation, decreased mitochondrial DNA content and have induced mitochondrial UPR measured by hsp-6::GFP levels. gsr-1(m-,z-) have aberrant perinuclear distribution of interphasic chromatin. NOTE: The RFP-labeled balancer is reportedly not entirely stable in this strain and will occasionally segregate recombinants of two types: sterile RFP+ animals (most likely homozygous qC1 [nIs281] worms that are able to grow to adulthood but do not develop germline), and non-RFP animals that lay viable progeny. Maintain by picking fertile RFP+ animals and confirming that non-RFP progeny lay 100% arrested embryos. Reference: Mora-Lorca JA, et al. Free Radic Biol Med. 2016 Jul;96:446-61.

Auxin-Inducible Degron (AID*) tag was inserted into the endogenous let-363 coding sequence via CRISPR/Cas9. This strain can be combined with TIR1-expressing strains to induce degradation of LET-363. Reference: Smith HJ, et al. PLoS Genetic. 2023 Sep 18;19(9):e1010938. doi: 10.1371/journal.pgen.1010938. PMID: 37721956.

Temperature sensitive: maintenance at 15-20C. Reduced number of progeny at elevated temperatures. PH domain added to the 3xFLAG::GFP-tagged endogenous wago-4 locus in parental strain YY1325. This allele localizes WAGO-4 to the plasma membrane, but de-localization is not complete (some residual germ granule signal is detected).

Temperature sensitive: maintain at 15-20C. Reduced number of progeny and mortal germline phenotype at elevated temperatures. Mitochondria Targeting Sequence (mts) added to the 3xFLAG::GFP-tagged endogenous wago-4 locus localizes tagged WAGO-4 to mitochondria. This allele was introduced into 3xFlag::GFP tagged endogenous wago-4 locus in parental strain YY1325.

Temperature sensitive: maintain at 15-20C. Reduced number of progeny and mortal germline phenotype at elevated temperatures. Engineered mutations of FG repeats in three Vasa like GLH proteins (GLH-1, GLH-2 and GLH-4). glh-1(jog50) is F to A substitution. glh-4(jog16) is F to A substitution. glh-2(jog49) is a deletion of the FG repeats. This strain exhibits a subtle change in germ granule composition while maintaining their architecture. WAGO-4 is mislocalized to the cytoplasm leading to compromised function.

Temperature sensitive: maintain at 15-20C. Reduced number of progeny at elevated temperatures. wago-4(jog272) is an engineered Y611E point mutation predicted to disrupt small RNA binding and exhibits a diffuse cytoplasmic localization. This allele was introduced into 3xFlag::GFP tagged endogenous wago-4 locus in parental strain YY1325.

axIs36 [pes-10::GFP]. Heterozygotes are Unc and sensitive to ivermectin. Segregates csr-1 homozygotes (sterile, non-Unc, resisitant to ivermectin), dead embryos, and Unc heterozygotes. Maintain by picking Uncs. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.

Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP ego-1 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.

Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP drh-3 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.

T07D3.7. Homozygous viable, contains an out of frame deletion removing nucleotides encoding amino acids 34-374. This strain cannot be distributed to for-profit companies. Do not distribute this strain; other labs should request it from the CGC. URL: http://www.celeganskoconsortium.omrf.org.

Heterozygotes are WT and segregate WT, Uncs that give dead embryos (src-1 homozygotes), dead eggs, and mid-larval lethals (hT1 homozygotes). src-1 is linked to an unknown Unc. [Feb 2005: Paul Mains has found a temperature-sensitive let-502 mutation (called sb118) linked to src-1 in this strain. Not sure if this is the Unc mutation mentioned here, or a third mutation on this chromosome.]

sprSi2 [pie-1p::GFP::histone-H2B::nos-2 3'UTR + Cbr-unc-119(+)] II. Fluorescence in all cells of early embryo. This fluorescence reporter has mutations in both MEX-3 binding sites and shows ectopic expression relative to strain WRM1. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.

Homozygous fertile, nearly fully penetrant embryonic lethal phenotype at 25C. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp) derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Derived by crossing parental strains WRM52 and OD1854. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.

Homozygous fertile. ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Derived by crossing parental strains DG4269 and OD1854. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.

neSi101 [sun-1p::TIR1::mRuby::eft-3 3'UTR + Cbr-unc-119(+)] IV. GFP reporter inserted into C-terminus of endogenous oma-1 locus. A triple arginine motif upstream of the oma-1 tandem zinc finger domain is mutated to three alanines. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. When OMA-2 is present, this mutant does not appear to have obvious phenotypes. Auxin-inducible depletion of OMA-2 causes embryonic lethality: animals lay low numbers of nonviable embryos that are often polynucleated and have weak chitin shells. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.

High zinc transcriptional activation - deficient (Zad-d). Avoid high zinc concentrations. [NOTE: this strain was previously described as hizr-1(am285); the correct allele name hizr-1(am286).] Reference: Warnhoff K, et al. PLoS Biol. 2017 Jan 17;15(1):e2000094.

Gain-of-function allele: modified ligand binding domain constitutively binds HZA element. High zinc transcriptional activation - constitutive (Zad-c). [NOTE: this strain was previously described as hizr-1(am286); the correct allele name hizr-1(am285).] Reference: Warnhoff K, et al. PLoS Biol. 2017 Jan 17;15(1):e2000094.

qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Relative stable expression of YFP::LMN-1 when grown at 24C. Expression of CFP::H2B is silenced. qaIs3502 is presumably not on LG III. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Commercial requests should be addressed to info@embl-em.de

qaEx3504 [pie-1::GFP::emr-1 + unc-119(+)]. Maintain by picking WT. Stable expression of GFP::EMR-1 when grown at 20C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Commercial requests should be addressed to info@embl-em.de

qaIs3507 [pie-1p::GFP::lem-2 + unc-119(+)] WT. Stable expression of GFP::LEM-2 when grown at 20C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Commercial requests should be addressed to info@embl-em.de

qaEx6900 [ftn-1p::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

qaEx6901 [ftn-2p::pes-10::GFP::his + lin-15(+)]. Segregates WT and Muv. Maintain by picking WT.

qaEx6902 [ftn-1p(delta63)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

ZC317.3 Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Length: 2746. Estimated Deletion Size: 1200. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/

R09B5.11 Homozygous. Outer Left Sequence: ctgtcgcaagtcctgattga. Outer Right Sequence: gtttccggaacaaacttcca. Inner Left Sequence: gaacgagtgtttctgggacg. Inner Right Sequence: atgaggaaggcgtactggtg. Inner Primer PCR Length: 3113. Deletion size: 1273 bp. Left flank: TATCAGTTTGAAGAGGCACTCGAAAACCTT. Right flank: ACTGTTCTATATATAAGCTGAAGTTCAACC. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/

oxIs12 [unc-47p::GFP + lin-15(+)]. Unc. Reference: Hammarlund M, et al. J Cell Biol. 2000 May 15;149(4):931-42. [NOTE: this strain grows very slowly and will take longer than usual to prepare for shipping.]

vtIs7 [dat-1p::GFP]. GFP expression in dopaminergic neurons. This strain was generated by crossing the mkk-4(jk91) mutation into the vtIs7 background. Reference: Gonzalez-Hunt CP, et al. PLoS One. 2014 Dec 8;9(12):e114459.

wpEx505 [ocr-3p::mEGFP + pha-1(+)]. Maintain at 23-25C to select for array. PVP neurons are marked with mEGFP. Can be used to isolate PVP by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). The ocr-3p::mEGFP plasmid used to generate this strain was provided by Dr. Patrick Laurent.

yp2 mutation perturbs the MRT-1 DNA-binding domain. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will become sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63.

Null allele. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will become sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63.