More Fields
Strain Species Genotype
VL530 C. elegans unc-119(ed3) III; wwIs20; leEx1583. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1583 [hlh-4::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL531 C. elegans unc-119(ed3) III; wwIs20; wwEx37. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx37 [ngn-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL536 C. elegans unc-119(ed3) III; wwIs20; leEx1566. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1566 [lin-32::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL551 C. elegans unc-119(ed3) III; wwIs20; wwEx40. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx40 [cnd-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL559 C. elegans unc-119(ed3) III; wwIs20; wwEx36. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx36 [hlh-19::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL562 C. elegans unc-119(ed3) III; wwIs20; wwIs19. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwIs19 [hlh-6::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL565 C. elegans unc-119(ed3) III; wwIs20; leEx1601. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1601 [hlh-8::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL566 C. elegans unc-119(ed3) III; wwIs20; leEx1546. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1546 [hlh-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL585 C. elegans unc-119(ed3) III; wwIs20; leEx1556. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1556 [hlh-12::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL586 C. elegans unc-119(ed3) III; wwIs20; wwEx42. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx42 [hlh-15::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VPR168 C. elegans wyEx915. Show Description
wyEx915 [hlh-17p::mCherry + unc-122p::GFP]. Low penetrance backwards coiler. This strain was produced by crossing TV2394 with N2 to remove wyIs45.
VT1289 C. elegans mir-63(n4568) X. Show Description
Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT1361 C. elegans mir-2(n4108) I. Show Description
Deletion breakpoints are:TCAAAAAAAAACTTCAAT / ATTTTTATGGTATCTTAC...CGAATCTCTTCAAGCAAT / TGGTACTATCTCGATGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT1362 C. elegans mir-70(n4109) V. Show Description
Deletion breakpoints are: ATTCATATTTCGATTAATAAAATTACCAAACA / CAATCCAACATAA...ATGGATACGCAGTA / AGAACAATATATGAACGATCGAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT733 C. remanei ssp. vulgaris Show Description
Male-female strain. Reference WBG 11(4):89. See also WBPaper00001874. May crawl off the plates. Isolated by Bill Fixsen at a rest area on the turnpike in Conn. Previously called WS9-6 and C. vulgaris NH and C. vulgariensis by the CGC. Walter Sudhaus has tentatively described this strain as C. remanei ssp. vulgaris; this description is not official and is contigent upon its being published. See WBPaper00002633.
VX300 C. elegans yfSi1 II. Show Description
yfSi1 [nspf-1p::nspf-1::6xHis::tbb-2 3' UTR + loxP, II:8420157]. C-terminal 6xHis-tagged NSPF-1 allows visualization of NSPF seminal fluid protein localization in males and hermaphrodites. Transgene inserted into ttTi5650 MosSCI site (II:8420157) using CRISPR/Cas9. Reference: Kasimatis KR, et al. (2022) No evidence of sexual conflict for a novel sperm-derived seminal fluid protein in Caenorhabditis nematodes. bioRxiv doi: https://doi.org/10.1101/2022.09.22.509081
VZ1 C. elegans trx-1(ok1449) II. Show Description
B0228.5 Homozygous. Exhibits slightly shortened lifespan compared to wild-type. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/ Reference: Miranda-Vizuete A, et al. FEBS Lett. 2006 Jan 23;580(2):484-90.
VZ454 C. elegans gsr-1(tm3574)/qC1 dpy-19(e1259) glp-1(q339) nIs281 III. Show Description
nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT and segregate WT, Dpy Sterile, and tm3574 homozygotes. gsr-1(tm3574) is embryonic lethal. gsr-1(m+,z-) animals are viable and reach adulthood with no visible phenotype and lay eggs that invariably arrest at the pregastrula stage; they are slightly short-lived, have increased mitochondrial fragmentation, decreased mitochondrial DNA content and have induced mitochondrial UPR measured by hsp-6::GFP levels. gsr-1(m-,z-) have aberrant perinuclear distribution of interphasic chromatin. NOTE: The RFP-labeled balancer is reportedly not entirely stable in this strain and will occasionally segregate recombinants of two types: sterile RFP+ animals (most likely homozygous qC1 [nIs281] worms that are able to grow to adulthood but do not develop germline), and non-RFP animals that lay viable progeny. Maintain by picking fertile RFP+ animals and confirming that non-RFP progeny lay 100% arrested embryos. Reference: Mora-Lorca JA, et al. Free Radic Biol Med. 2016 Jul;96:446-61.
WBM1481 C. elegans let-363(wbm46[AID::let-363]) I. Show Description
Auxin-Inducible Degron (AID) tag was inserted into the endogenous let-363 coding sequence via CRISPR/Cas9. This strain can be combined with TIR1-expressing strains to induce degradation of LET-363. Reference: Smith HJ, et al. PLoS Genetic. 2023 Sep 18;19(9):e1010938. doi: 10.1371/journal.pgen.1010938. PMID: 37721956.
WM214 C. elegans avr-14(ad1302) I; csr-1(tm892)/nT1 [unc-?(n754) let-?] IV; avr-15(ad1051) glc-1(pk54))/nT1 V; axIs36 X. Show Description
axIs36 [pes-10::GFP]. Heterozygotes are Unc and sensitive to ivermectin. Segregates csr-1 homozygotes (sterile, non-Unc, resisitant to ivermectin), dead embryos, and Unc heterozygotes. Maintain by picking Uncs. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
WM215 C. elegans avr-14(ad1302) ego-1(om97) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); avr-15(ad1051) glc-1(pk54)) V. Show Description
Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP ego-1 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
WM216 C. elegans avr-14(ad1302) drh-3(tm1217) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); avr-15(ad1051) glc-1(pk54)) V. Show Description
Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP drh-3 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
WM53 C. elegans alg-2(ok304) II. Show Description
T07D3.7. Homozygous viable, contains an out of frame deletion removing nucleotides encoding amino acids 34-374. This strain cannot be distributed to for-profit companies. Do not distribute this strain; other labs should request it from the CGC. URL: http://www.celeganskoconsortium.omrf.org.
WM65 C. elegans src-1(cj293) let-502(sb118)/hT1 I; +/hT1 V. Show Description
Heterozygotes are WT and segregate WT, Uncs that give dead embryos (src-1 homozygotes), dead eggs, and mid-larval lethals (hT1 homozygotes). src-1 is linked to an unknown Unc. [Feb 2005: Paul Mains has found a temperature-sensitive let-502 mutation (called sb118) linked to src-1 in this strain. Not sure if this is the Unc mutation mentioned here, or a third mutation on this chromosome.]
WRM2 C. elegans sprSi2 II; unc-119(ed3) III. Show Description
sprSi2 [pie-1p::GFP::histone-H2B::nos-2 3'UTR + Cbr-unc-119(+)] II. Fluorescence in all cells of early embryo. This fluorescence reporter has mutations in both MEX-3 binding sites and shows ectopic expression relative to strain WRM1. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
WU1500 C. elegans hizr-1(am286) X. Show Description
High zinc transcriptional activation - deficient (Zad-d). Avoid high zinc concentrations. [NOTE: this strain was previously described as hizr-1(am285); the correct allele name hizr-1(am286).] Reference: Warnhoff K, et al. PLoS Biol. 2017 Jan 17;15(1):e2000094.
WU1563 C. elegans hizr-1(am285) X. Show Description
Gain-of-function allele: modified ligand binding domain constitutively binds HZA element. High zinc transcriptional activation - constitutive (Zad-c). [NOTE: this strain was previously described as hizr-1(am286); the correct allele name hizr-1(am285).] Reference: Warnhoff K, et al. PLoS Biol. 2017 Jan 17;15(1):e2000094.
XA3502 C. elegans unc-119(ed3) III; qaIs3502. Show Description
qaIs3502[unc-119(+) + pie-1::YFP::lmn-1 + pie-1::CFP::H2B] Relative stable expression of YFP::LMN-1 when grown at 24C. Expression of CFP::H2B is silenced. qaIs3502 is presumably not on LG III. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Commercial requests should be addressed to info@embl-em.de
XA3504 C. elegans unc-119(ed3) III; qaEx3504. Show Description
qaEx3504 [pie-1::GFP::emr-1 + unc-119(+)]. Maintain by picking WT. Stable expression of GFP::EMR-1 when grown at 20C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Commercial requests should be addressed to info@embl-em.de
XA3507 C. elegans unc-119(ed3) qaIs3507 III. Show Description
qaIs3507 [unc-119(+) + pie-1p::GFP::lem-2] WT. Stable expression of GFP::LEM-2 when grown at 20C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Commercial requests should be addressed to info@embl-em.de
XA6900 C. elegans pha-1(e2123) III; qaEx6900. Show Description
qaEx6900 [ftn-1p::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
XA6901 C. elegans lin-15B&lin-15A(n765) X; qaEx6901. Show Description
qaEx6901 [ftn-2p::pes-10::GFP::his + lin-15(+)]. Segregates WT and Muv. Maintain by picking WT.
XA6902 C. elegans pha-1(e2123) III; qaEx6902. Show Description
qaEx6902 [ftn-1p(delta63)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
XA7400 C. elegans glc-3(ok321) V. Show Description
ZC317.3 Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Length: 2746. Estimated Deletion Size: 1200. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/
XA7401 C. elegans R09B5.11(ok1759) V. Show Description
R09B5.11 Homozygous. Outer Left Sequence: ctgtcgcaagtcctgattga. Outer Right Sequence: gtttccggaacaaacttcca. Inner Left Sequence: gaacgagtgtttctgggacg. Inner Right Sequence: atgaggaaggcgtactggtg. Inner Primer PCR Length: 3113. Deletion size: 1273 bp. Left flank: TATCAGTTTGAAGAGGCACTCGAAAACCTT. Right flank: ACTGTTCTATATATAAGCTGAAGTTCAACC. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/
XE1002 C. elegans unc-70(s1502) V; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Unc. Reference: Hammarlund M, et al. J Cell Biol. 2000 May 15;149(4):931-42. [NOTE: this strain grows very slowly and will take longer than usual to prepare for shipping.]
XE1311 C. elegans mkk-4(ju91) X; vtIs7. Show Description
vtIs7 [dat-1p::GFP]. GFP expression in dopaminergic neurons. This strain was generated by crossing the mkk-4(jk91) mutation into the vtIs7 background. Reference: Gonzalez-Hunt CP, et al. PLoS One. 2014 Dec 8;9(12):e114459.
XE3004 C. elegans pha-1(e2123) III; wpEx505. Show Description
wpEx505 [ocr-3p::mEGFP + pha-1(+)]. Maintain at 23-25C to select for array. PVP neurons are marked with mEGFP. Can be used to isolate PVP by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). The ocr-3p::mEGFP plasmid used to generate this strain was provided by Dr. Patrick Laurent.
YA1039 C. elegans mrt-1(yp2) I. Show Description
yp2 mutation perturbs the MRT-1 DNA-binding domain. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will become sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63.
YA1116 C. elegans mrt-1(tm1354) I. Show Description
Null allele. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will become sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63.
YA893 C. elegans mrt-1(e2662) I. Show Description
Null allele. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will become sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63. [NOTE: allele is incorrectly described as e2661 in this publication.]
YS2 C. elegans cbp-1(bm1) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys2 is an internal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA1000 cbp-1(ys2) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
YS4 C. elegans cbp-1(bm2) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys4 is an N-terminal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA990 cbp-1(ys4) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
YT17 C. elegans crh-1(tz2) III. Show Description
Clumpy, pale and slightly small, tend to dig into plate. Daf-c at 27C. Do not distribute this strain; other labs should request it from the CGC.
YY1325 C. elegans wago-4(gg620[3xflag::gfp::wago-4]) II. Show Description
3xflag::gfp inserted into endogenous wago-4 locus using CRISPR/Cas9 engineering. 3xFLAG::GFP::WAGO-4 is partially functional in this strain. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
ZM11086 C. elegans hpEx4362. Show Description
hpEx4362 [flp-18p::cha-1(sense) + twk-40p::cha-1(antisense) + ttx-3p::GFP]. Pick animals with GFP expression in AIY to maintain. Transgenic animals exhibit reduced forward speed and body bending; this phenotype is not fully penetrate.
ZM588 C. elegans fsn-1(hp1) III; juIs1 IV; scd-2(ok565) V. Show Description
juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Animals are WT looking. In WT, GABAergic synapses visualized with juIs1 (GABAergic nervous system specific synaptobrevin::GFP) marker show uniformly spaced and sized puncta. fsn-1(hp1); scd-2(ok565) animals have puncta close to WT shape. This is more evident in larvae than in adults.
ZM8202 C. elegans ubr-1(hp821 hp833) I. Show Description
Stiff backing. Presumptive null. This strain carries two CRISPR-engineered deletions to ensure complete knockout of ubr-1 function. hp821 is a deletion in the 5 ' end of ubr-1 and hp833 is a deletion near the 3' end of the gene. Reference: Chiturri J, et al. PLoS Genet. 2018 Apr 12;14(4):e1007303. doi: 10.1371/journal.pgen.1007303. eCollection 2018 Apr. PMID: 29649217.
ZM8230 C. elegans ubr-1(hp684) I. Show Description
hp684(Q1864X) mutant animals generate reversal movement with little flexing of the posterior body, and the stiffness is prominent during prolonged reversals. This phenotype is progressive, and most prominent when animals develop from the L4 stage larvae into adults. Reference: Chitturi JH, et al. PLoS Genetics. 2018;14(4):e1007303.
ZM8428 C. elegans hpIs459. Show Description
hpIs459 [unc-4p::GCaMP3::wCherry + lin-15(+)]. Strong GCaMP3 and wCherry expression in A-class motor neurons, as well as some head and tail neurons. It is recommended to use L4 stage animals when using this strain for calcium imaging and recording. Transgene expression becomes dimmer in many A-class neurons (except DA9), and is expression in VC neurons of adults. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035