More Fields
Strain Species Genotype
TY3558 C. elegans unc-119(ed3) ruIs32 III; ojIs1. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Histone and tubulin GFP.
VH1075 C. elegans rhIs4 hdIs26 III; fmi-1(rh308) V. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdIs26 [odr-2p::CFP + sra-6p::DsRed2] III. Ventral cord cross-over defects. PVQ axons sometimes stop short or leave the ventral cord. Reference: Steimel A, et al. Development. 2010 Nov;137(21):3663-73.
VH1160 C. elegans ast-1(hd92) II; rhIs4 III; hdEx237. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdEx237 [ast-1(+) + rol-6(su1006)]. hd92 arrests as L1 due to pharyngeal differentiation defects; ventral cord midline crossing defects; rescued with ast-1(+) transgene. Rollers.
VH1565 C. elegans rhIs4 hdIs26 III; fmi-1(hd121) V. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdIs26 [odr-2p::CFP + sra-6p::DsRed2] III. Ventral cord cross-over defects. PVQ axons sometimes stop short or leave the ventral cord. Reference: Steimel A, et al. Development. 2010 Nov;137(21):3663-73.
VH17 C. elegans ast-1(rh300) II; rhIs4 III. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. Ventral cord midline crossing defects.
VH29 C. elegans cdh-4(rh310) rhIs4 III. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. Lateral axons and ventral cord cross-over defects. Partially penetrant embryonic and larval lethality. Reference: Schmitz C, et al. Dev Biol. 2008 Apr 15;316(2):249-59.
VH4 C. elegans rhIs4 III; zag-1(rh315) IV. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. Hypomorph. Unc. Axon outgrowth defects and misexpression of glr-1::GFP marker.
VH624 C. elegans rhIs13 V; nre-1(hd20) lin-15B(hd126) X. Show Description
rhIs13 [unc-119::GFP + dpy-20(+)]. RNAi hypersensitive, effective RNAi in the nervous system. unc-119::GFP in neurons is almost completely suppressed on anti-GFP RNAi plates. Reduced progeny at 25C (almost sterile). nre-1(hd20) and lin-15B(hd126) seem very closely linked. Maintain at 15C or 20C.
WBM34 C. elegans uthIs205. Show Description
uthIs205 [crtc-1p::crtc-1::tdTOMATO::unc-54 3'UTR + rol-6(su1006)]. Rollers. tdTOMATO-tagged CRTC-1 expression from native promoter. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WBM55 C. elegans uthIs226. Show Description
uthIs226 [crtc-1p::crtc-1(S76A, S179A)::tdTOMATO::unc-54 3'UTR + rol-6(su1006)]. Rollers. tdTOMATO-tagged, non-phosphorylatable CRTC-1 expression from native promoter. Constitutively nuclear expression in neurons and intestine. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WBM60 C. elegans uthIs248. Show Description
uthIs248 [aak-2p::aak-2(genomic aa1-321)::GFP::unc-54 3'UTR + myo-2p::tdTOMATO]. Ubiquitous GFP expression and pharynx-specific tdTomato expression. Small with slight developmental delay and reduced reproductive capacity. Some phenotypes silence quickly. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WRM1 C. elegans sprSi1 II; unc-119(ed3) III. Show Description
sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
WRM3 C. elegans sprSi3 II; unc-119(ed3) III. Show Description
sprSi3 [mex-5p::GFP::histone-H2B::glp-1 3'UTR + Cbr-unc-119(+)] II. Fluorescence in the distal germline and in early embryos. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
WU970 C. elegans haly-1(am132) X. Show Description
Resistance to excess dietary zinc and nickel observed on noble agar minimal media with supplemental zinc or nickel; elevated levels of histidine observed in C. elegans on minimal media. Reference: Murphy JT, et al. PLoS Genet. 2011 Mar;7(3):e1002013.
WU971 C. elegans haly-1(am130) X. Show Description
Resistance to excess dietary zinc and nickel observed on noble agar minimal media with supplemental zinc or nickel; elevated levels of histidine observed in C. elegans on minimal media. Reference: Murphy JT, et al. PLoS Genet. 2011 Mar;7(3):e1002013.
XA3501 C. elegans unc-119(ed3) ruIs32 III; ojIs1. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Stable expression of GFP::histoneH2B and GFP::beta-tubulin when grown at 16-25C. ruIs32 contains plasmid pAZ132. ojIs1 is not on LG I, II, or IV.
XA8106 C. elegans hcf-1(pk924) IV. Show Description
Pleiotropic defects including reduced broodsize, reduced levels of histone H3 serine 10 phosphorylation, cold-sensitive embryonic lethality, cold-sensitive early embryonic mitotic and cytokinetic defects. Reference: Lee S, et al. PLoS One. 2007 Nov 28;2(11):e1213.
ZM11286 C. elegans hpIs636; hpEx4479. Show Description
hpIs636 [rig-3p::HisCl1::SL2::mCherry]. hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. Synapse exocytosis marker in AVA. Transgenic animals exhibit punctate green fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background. mCherry and HisCl1 expression in AVA soma and neurites. In the presence of histamine, the SNB-1::pHluorin intensity will decrease in neurites.
ZM9354 C. elegans hpIs636. Show Description
hpIs636 [rig-3p::HisCl1::SL2::mCherry]. mCherry expression in AVA soma and neurites along VNC. Non-specific mCherry expression in gut. HisCl activation leads to reduced forward and reversal activity.
ZT31 C. elegans cec-4(ok3124) cec-5(fj61) him-8(e1489) IV. Show Description
Maintain at 20C or lower. Him. cec-4 cec-5 him-8 triple mutants exhibit partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. ok3124 deletion can be detceted by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj61 is a 444-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-5 (F32E10.6). The fj61 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT35 C. elegans cec-8(fj63) III; cec-4(ok3124) cec-5(fj61) him-8(e1489) IV. Show Description
Maintain at 20C or lower. Him. The cec-8; cec-4 cec-5 him-8 quadruple mutant exhibits partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.